ID: 900196937

View in Genome Browser
Species Human (GRCh38)
Location 1:1381267-1381289
Sequence CCACAAGGTGGGGGTGGGTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900196937_900196947 -2 Left 900196937 1:1381267-1381289 CCGAACCCACCCCCACCTTGTGG No data
Right 900196947 1:1381288-1381310 GGCTGGCGACCCTCACTTTCCGG No data
900196937_900196950 11 Left 900196937 1:1381267-1381289 CCGAACCCACCCCCACCTTGTGG No data
Right 900196950 1:1381301-1381323 CACTTTCCGGATGCTGAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900196937 Original CRISPR CCACAAGGTGGGGGTGGGTT CGG (reversed) Intergenic