ID: 900196941

View in Genome Browser
Species Human (GRCh38)
Location 1:1381273-1381295
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900196941_900196954 28 Left 900196941 1:1381273-1381295 CCACCCCCACCTTGTGGCTGGCG No data
Right 900196954 1:1381324-1381346 CTCCAGTTGCCAGAGCTCCAGGG No data
900196941_900196947 -8 Left 900196941 1:1381273-1381295 CCACCCCCACCTTGTGGCTGGCG No data
Right 900196947 1:1381288-1381310 GGCTGGCGACCCTCACTTTCCGG No data
900196941_900196953 27 Left 900196941 1:1381273-1381295 CCACCCCCACCTTGTGGCTGGCG No data
Right 900196953 1:1381323-1381345 GCTCCAGTTGCCAGAGCTCCAGG No data
900196941_900196950 5 Left 900196941 1:1381273-1381295 CCACCCCCACCTTGTGGCTGGCG No data
Right 900196950 1:1381301-1381323 CACTTTCCGGATGCTGAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900196941 Original CRISPR CGCCAGCCACAAGGTGGGGG TGG (reversed) Intergenic