ID: 900196942

View in Genome Browser
Species Human (GRCh38)
Location 1:1381276-1381298
Sequence GGTCGCCAGCCACAAGGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900196942_900196953 24 Left 900196942 1:1381276-1381298 CCCCCACCTTGTGGCTGGCGACC No data
Right 900196953 1:1381323-1381345 GCTCCAGTTGCCAGAGCTCCAGG No data
900196942_900196954 25 Left 900196942 1:1381276-1381298 CCCCCACCTTGTGGCTGGCGACC No data
Right 900196954 1:1381324-1381346 CTCCAGTTGCCAGAGCTCCAGGG No data
900196942_900196950 2 Left 900196942 1:1381276-1381298 CCCCCACCTTGTGGCTGGCGACC No data
Right 900196950 1:1381301-1381323 CACTTTCCGGATGCTGAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900196942 Original CRISPR GGTCGCCAGCCACAAGGTGG GGG (reversed) Intergenic