ID: 900196943

View in Genome Browser
Species Human (GRCh38)
Location 1:1381277-1381299
Sequence GGGTCGCCAGCCACAAGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900196943_900196950 1 Left 900196943 1:1381277-1381299 CCCCACCTTGTGGCTGGCGACCC No data
Right 900196950 1:1381301-1381323 CACTTTCCGGATGCTGAACCAGG No data
900196943_900196954 24 Left 900196943 1:1381277-1381299 CCCCACCTTGTGGCTGGCGACCC No data
Right 900196954 1:1381324-1381346 CTCCAGTTGCCAGAGCTCCAGGG No data
900196943_900196953 23 Left 900196943 1:1381277-1381299 CCCCACCTTGTGGCTGGCGACCC No data
Right 900196953 1:1381323-1381345 GCTCCAGTTGCCAGAGCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900196943 Original CRISPR GGGTCGCCAGCCACAAGGTG GGG (reversed) Intergenic