ID: 900196946

View in Genome Browser
Species Human (GRCh38)
Location 1:1381282-1381304
Sequence AGTGAGGGTCGCCAGCCACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900196946_900196950 -4 Left 900196946 1:1381282-1381304 CCTTGTGGCTGGCGACCCTCACT No data
Right 900196950 1:1381301-1381323 CACTTTCCGGATGCTGAACCAGG No data
900196946_900196953 18 Left 900196946 1:1381282-1381304 CCTTGTGGCTGGCGACCCTCACT No data
Right 900196953 1:1381323-1381345 GCTCCAGTTGCCAGAGCTCCAGG No data
900196946_900196954 19 Left 900196946 1:1381282-1381304 CCTTGTGGCTGGCGACCCTCACT No data
Right 900196954 1:1381324-1381346 CTCCAGTTGCCAGAGCTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900196946 Original CRISPR AGTGAGGGTCGCCAGCCACA AGG (reversed) Intergenic