ID: 900196947

View in Genome Browser
Species Human (GRCh38)
Location 1:1381288-1381310
Sequence GGCTGGCGACCCTCACTTTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900196934_900196947 21 Left 900196934 1:1381244-1381266 CCTGAGCCACTTCGGAGCAGAGG No data
Right 900196947 1:1381288-1381310 GGCTGGCGACCCTCACTTTCCGG No data
900196941_900196947 -8 Left 900196941 1:1381273-1381295 CCACCCCCACCTTGTGGCTGGCG No data
Right 900196947 1:1381288-1381310 GGCTGGCGACCCTCACTTTCCGG No data
900196940_900196947 -7 Left 900196940 1:1381272-1381294 CCCACCCCCACCTTGTGGCTGGC No data
Right 900196947 1:1381288-1381310 GGCTGGCGACCCTCACTTTCCGG No data
900196936_900196947 15 Left 900196936 1:1381250-1381272 CCACTTCGGAGCAGAGGCCGAAC No data
Right 900196947 1:1381288-1381310 GGCTGGCGACCCTCACTTTCCGG No data
900196933_900196947 27 Left 900196933 1:1381238-1381260 CCGGGACCTGAGCCACTTCGGAG No data
Right 900196947 1:1381288-1381310 GGCTGGCGACCCTCACTTTCCGG No data
900196937_900196947 -2 Left 900196937 1:1381267-1381289 CCGAACCCACCCCCACCTTGTGG No data
Right 900196947 1:1381288-1381310 GGCTGGCGACCCTCACTTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900196947 Original CRISPR GGCTGGCGACCCTCACTTTC CGG Intergenic