ID: 900196948

View in Genome Browser
Species Human (GRCh38)
Location 1:1381297-1381319
Sequence GTTCAGCATCCGGAAAGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900196948_900196957 17 Left 900196948 1:1381297-1381319 CCCTCACTTTCCGGATGCTGAAC No data
Right 900196957 1:1381337-1381359 AGCTCCAGGGCACCCATGCCAGG No data
900196948_900196954 4 Left 900196948 1:1381297-1381319 CCCTCACTTTCCGGATGCTGAAC No data
Right 900196954 1:1381324-1381346 CTCCAGTTGCCAGAGCTCCAGGG No data
900196948_900196953 3 Left 900196948 1:1381297-1381319 CCCTCACTTTCCGGATGCTGAAC No data
Right 900196953 1:1381323-1381345 GCTCCAGTTGCCAGAGCTCCAGG No data
900196948_900196959 23 Left 900196948 1:1381297-1381319 CCCTCACTTTCCGGATGCTGAAC No data
Right 900196959 1:1381343-1381365 AGGGCACCCATGCCAGGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900196948 Original CRISPR GTTCAGCATCCGGAAAGTGA GGG (reversed) Intergenic