ID: 900196950

View in Genome Browser
Species Human (GRCh38)
Location 1:1381301-1381323
Sequence CACTTTCCGGATGCTGAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900196941_900196950 5 Left 900196941 1:1381273-1381295 CCACCCCCACCTTGTGGCTGGCG No data
Right 900196950 1:1381301-1381323 CACTTTCCGGATGCTGAACCAGG No data
900196942_900196950 2 Left 900196942 1:1381276-1381298 CCCCCACCTTGTGGCTGGCGACC No data
Right 900196950 1:1381301-1381323 CACTTTCCGGATGCTGAACCAGG No data
900196936_900196950 28 Left 900196936 1:1381250-1381272 CCACTTCGGAGCAGAGGCCGAAC No data
Right 900196950 1:1381301-1381323 CACTTTCCGGATGCTGAACCAGG No data
900196946_900196950 -4 Left 900196946 1:1381282-1381304 CCTTGTGGCTGGCGACCCTCACT No data
Right 900196950 1:1381301-1381323 CACTTTCCGGATGCTGAACCAGG No data
900196937_900196950 11 Left 900196937 1:1381267-1381289 CCGAACCCACCCCCACCTTGTGG No data
Right 900196950 1:1381301-1381323 CACTTTCCGGATGCTGAACCAGG No data
900196944_900196950 0 Left 900196944 1:1381278-1381300 CCCACCTTGTGGCTGGCGACCCT No data
Right 900196950 1:1381301-1381323 CACTTTCCGGATGCTGAACCAGG No data
900196943_900196950 1 Left 900196943 1:1381277-1381299 CCCCACCTTGTGGCTGGCGACCC No data
Right 900196950 1:1381301-1381323 CACTTTCCGGATGCTGAACCAGG No data
900196940_900196950 6 Left 900196940 1:1381272-1381294 CCCACCCCCACCTTGTGGCTGGC No data
Right 900196950 1:1381301-1381323 CACTTTCCGGATGCTGAACCAGG No data
900196945_900196950 -1 Left 900196945 1:1381279-1381301 CCACCTTGTGGCTGGCGACCCTC No data
Right 900196950 1:1381301-1381323 CACTTTCCGGATGCTGAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900196950 Original CRISPR CACTTTCCGGATGCTGAACC AGG Intergenic