ID: 900196953

View in Genome Browser
Species Human (GRCh38)
Location 1:1381323-1381345
Sequence GCTCCAGTTGCCAGAGCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900196942_900196953 24 Left 900196942 1:1381276-1381298 CCCCCACCTTGTGGCTGGCGACC No data
Right 900196953 1:1381323-1381345 GCTCCAGTTGCCAGAGCTCCAGG No data
900196951_900196953 -7 Left 900196951 1:1381307-1381329 CCGGATGCTGAACCAGGCTCCAG 0: 1
1: 0
2: 7
3: 34
4: 238
Right 900196953 1:1381323-1381345 GCTCCAGTTGCCAGAGCTCCAGG No data
900196945_900196953 21 Left 900196945 1:1381279-1381301 CCACCTTGTGGCTGGCGACCCTC No data
Right 900196953 1:1381323-1381345 GCTCCAGTTGCCAGAGCTCCAGG No data
900196940_900196953 28 Left 900196940 1:1381272-1381294 CCCACCCCCACCTTGTGGCTGGC No data
Right 900196953 1:1381323-1381345 GCTCCAGTTGCCAGAGCTCCAGG No data
900196941_900196953 27 Left 900196941 1:1381273-1381295 CCACCCCCACCTTGTGGCTGGCG No data
Right 900196953 1:1381323-1381345 GCTCCAGTTGCCAGAGCTCCAGG No data
900196948_900196953 3 Left 900196948 1:1381297-1381319 CCCTCACTTTCCGGATGCTGAAC No data
Right 900196953 1:1381323-1381345 GCTCCAGTTGCCAGAGCTCCAGG No data
900196944_900196953 22 Left 900196944 1:1381278-1381300 CCCACCTTGTGGCTGGCGACCCT No data
Right 900196953 1:1381323-1381345 GCTCCAGTTGCCAGAGCTCCAGG No data
900196943_900196953 23 Left 900196943 1:1381277-1381299 CCCCACCTTGTGGCTGGCGACCC No data
Right 900196953 1:1381323-1381345 GCTCCAGTTGCCAGAGCTCCAGG No data
900196949_900196953 2 Left 900196949 1:1381298-1381320 CCTCACTTTCCGGATGCTGAACC No data
Right 900196953 1:1381323-1381345 GCTCCAGTTGCCAGAGCTCCAGG No data
900196946_900196953 18 Left 900196946 1:1381282-1381304 CCTTGTGGCTGGCGACCCTCACT No data
Right 900196953 1:1381323-1381345 GCTCCAGTTGCCAGAGCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900196953 Original CRISPR GCTCCAGTTGCCAGAGCTCC AGG Intergenic