ID: 900197907

View in Genome Browser
Species Human (GRCh38)
Location 1:1386435-1386457
Sequence GTGTGCTTGTGAAAGTGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 176}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900197907_900197910 11 Left 900197907 1:1386435-1386457 CCTGGACACTTTCACAAGCACAC 0: 1
1: 0
2: 1
3: 20
4: 176
Right 900197910 1:1386469-1386491 CTACCACGTCCATAACGCTCCGG 0: 1
1: 0
2: 0
3: 3
4: 11
900197907_900197913 24 Left 900197907 1:1386435-1386457 CCTGGACACTTTCACAAGCACAC 0: 1
1: 0
2: 1
3: 20
4: 176
Right 900197913 1:1386482-1386504 AACGCTCCGGATGTCCTGAGTGG 0: 1
1: 0
2: 0
3: 0
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900197907 Original CRISPR GTGTGCTTGTGAAAGTGTCC AGG (reversed) Intronic
900197907 1:1386435-1386457 GTGTGCTTGTGAAAGTGTCCAGG - Intronic
900306245 1:2010024-2010046 GTGTGCTTGGGAGGGTGCCCAGG + Intergenic
901343676 1:8518994-8519016 GTGTGGGTGTGACAGTGTCATGG - Intronic
901595250 1:10379889-10379911 GGGTGCTTGTGGCAGTGGCCGGG + Intronic
902785335 1:18729478-18729500 GTGTGCATGTGTAAGTGTATTGG + Intronic
903388954 1:22950335-22950357 CTGTGCTGGTGAAAATGTTCTGG + Intergenic
904254979 1:29249177-29249199 GTGTGCGTGTGAGTGTGTGCAGG - Intronic
904563122 1:31412075-31412097 GTGTGTTTGTGGAACAGTCCTGG + Intronic
904936398 1:34132554-34132576 ATGTGTTTGTGAAGGTGTTCAGG + Intronic
905347199 1:37319212-37319234 GTGTGCGTGTGTATGTGTCTGGG + Intergenic
906525760 1:46492274-46492296 TTGTGCATGTGAAAGTGGCTAGG - Intergenic
908031915 1:60009621-60009643 GTGTGCGTGTGTGTGTGTCCGGG - Intronic
913076868 1:115347568-115347590 GTGTGCCTGTGTATGTGTGCTGG - Intergenic
913159717 1:116133828-116133850 GTGTGCCTATGAAACTGTGCTGG + Exonic
917506297 1:175630031-175630053 GTGTGCTTTAGGGAGTGTCCTGG - Intronic
921327642 1:214002708-214002730 TTGTGCGTGTGTAAGTATCCTGG + Intronic
1064630912 10:17309653-17309675 GTGTGGGTGTGAATGTGTCCTGG + Intergenic
1067031388 10:42880375-42880397 GTGTGCGAGTGGGAGTGTCCAGG + Intergenic
1067081495 10:43215061-43215083 GTGTGCTTGTCCACATGTCCAGG - Intronic
1068331917 10:55582113-55582135 TGGTGCCTGAGAAAGTGTCCGGG + Intronic
1073511888 10:104047636-104047658 GTGTGCATGTGCAGGTGTGCAGG - Intronic
1076139335 10:128067205-128067227 GTGTGCATGTGAATGTGTGTGGG - Intronic
1078567226 11:12426686-12426708 GTATGTTTGTGAAAGGGGCCAGG + Intronic
1079691133 11:23418432-23418454 GTGTGCATGTGAATGTGTCCTGG - Intergenic
1079778941 11:24573771-24573793 GTGTGCTTTTTAAAGTTTCTAGG - Intronic
1079993441 11:27270627-27270649 GTGGGAGTGTGTAAGTGTCCAGG + Intergenic
1080634574 11:34112364-34112386 GTGTACTTTGGAAAGTGGCCAGG - Intronic
1081638023 11:44733850-44733872 GTGTCCTTGTGAGAGTGGGCAGG + Intronic
1083686590 11:64380207-64380229 GTGAGCGTGTGAACGTGTGCGGG + Intergenic
1087916142 11:103813139-103813161 ATTTGCTTGTCAAAGTTTCCTGG - Intergenic
1090947595 11:131445631-131445653 GTGTACTAGTGTAAGTGACCAGG + Intronic
1092351275 12:7757867-7757889 ATGTACTTGAGAAAATGTCCTGG - Intergenic
1093140784 12:15508304-15508326 GTGTGCATGTGAGAGTATTCTGG - Intronic
1093577368 12:20748764-20748786 GTTTGCTTGTGAGTATGTCCAGG + Intronic
1101717237 12:107321327-107321349 GTGTGCTTGTGAGTGTGCGCAGG + Intronic
1101868499 12:108542145-108542167 TTGTGCGTGTTAAAGTGTTCAGG - Intronic
1102045457 12:109827278-109827300 GTGTGCTTGAGTGAGTGTCCTGG - Intronic
1102194820 12:111017640-111017662 GGGTGTATCTGAAAGTGTCCGGG + Intergenic
1108809619 13:54205472-54205494 GTGTGCCTGTGCAAATGGCCTGG + Intergenic
1109084996 13:57959292-57959314 CTGTGCCTGTGAACCTGTCCAGG + Intergenic
1109144833 13:58766344-58766366 GTGTGTTTGTGTATGTGTGCTGG + Intergenic
1112789864 13:102991494-102991516 TTGTGCTTTTAAAAGTTTCCTGG + Intergenic
1113613808 13:111666491-111666513 GTGTGCATGTGCATGTGTGCAGG + Intronic
1113734235 13:112665877-112665899 GTGTGCATGTGTGAGTGTGCGGG + Intronic
1120077003 14:80170082-80170104 GTGTTCTTGTGAAAGGGACATGG + Intergenic
1121423793 14:93833894-93833916 GAATGGTTCTGAAAGTGTCCCGG - Intergenic
1121605896 14:95239523-95239545 ATGTTTTTGTGAAAGTGTTCCGG + Intronic
1122090093 14:99332357-99332379 GTGTGCTTGTGTGTGTGTGCTGG - Intergenic
1122090130 14:99332900-99332922 GTGTGCTTGTGTGTGTGTGCTGG - Intergenic
1122090153 14:99333241-99333263 GTGTGCTTGTGTGTGTGTGCTGG - Intergenic
1124322435 15:28725274-28725296 GTGTGTTTGTGAGTGTTTCCAGG - Intronic
1124503932 15:30255562-30255584 GTGGGCTTGTGCAAGTGTGCAGG - Intergenic
1124739622 15:32283078-32283100 GTGGGCTTGTGCAAGTGTGCAGG + Intergenic
1126426426 15:48531527-48531549 GTGCCCTTGTGAAAATGTCCTGG - Intronic
1126968555 15:54083764-54083786 CTGTGCTTGTGAAAGTCTGAGGG + Intronic
1127398686 15:58564266-58564288 GTGGGCTTGGGAAGGGGTCCAGG + Intronic
1131854753 15:96581731-96581753 GTGGGCTTATGAAACTGTCATGG - Intergenic
1132973927 16:2702183-2702205 GTGTGCTCGTGCAGGTGTTCCGG + Intronic
1133198860 16:4190123-4190145 GTGTTCTTGTGGAAGGGTCCAGG + Exonic
1133714436 16:8433351-8433373 TTGTGCCTGTGGAAGTCTCCCGG - Intergenic
1133896218 16:9931836-9931858 GTGTGTTTGTGAATGTCTACAGG - Intronic
1134107856 16:11496724-11496746 GTGTGCCTATGCATGTGTCCAGG + Intronic
1134126915 16:11622288-11622310 GTGTGTTTGGGAAAGCGTTCAGG - Intronic
1135463458 16:22664843-22664865 GGGTGCATGTGCAAGGGTCCTGG + Intergenic
1135541195 16:23331621-23331643 GTGTACTTATAAAAGTGACCAGG - Intronic
1138985835 16:62327614-62327636 GTGTACTTTTTAAAGTGGCCGGG - Intergenic
1142259135 16:89034400-89034422 GTGTGCATGTGAGTGTGTGCAGG - Intergenic
1142315000 16:89338132-89338154 GGGTGCTTGGGGCAGTGTCCTGG - Intronic
1145264244 17:21371920-21371942 GTGTGGGTGTGACTGTGTCCTGG + Intergenic
1146285043 17:31568630-31568652 GTGTGCCTGTGACAGCGACCTGG - Intergenic
1148854514 17:50571418-50571440 GTGTGCGTGTGAATGTGTGCGGG + Intronic
1150565285 17:66333610-66333632 CTGTGCTTGTGAAGGGGTCTGGG + Intronic
1151497146 17:74465252-74465274 GTGTGTTTGTGAATGTGTGTGGG + Intergenic
1151497156 17:74465638-74465660 GTGTGTTTGTGAATGTGTGTGGG + Intergenic
1151497161 17:74465754-74465776 GTGTGTTTGTGAATGTGTGTGGG + Intergenic
1151497163 17:74465804-74465826 GTGTGTTTGTGAATGTGTGTGGG + Intergenic
1151497165 17:74465858-74465880 GTGTGTTTGTGAATGTGTGTGGG + Intergenic
1151497167 17:74465906-74465928 GTGTGTTTGTGAATGTGTGTGGG + Intergenic
1151980583 17:77506264-77506286 GGGTCCATGTGAAAGAGTCCAGG + Intergenic
1152088253 17:78232975-78232997 GTGTGCATGTGAGAGTGTGTGGG + Intronic
1153958719 18:10122282-10122304 ATTGGCTGGTGAAAGTGTCCTGG + Intergenic
1157200219 18:45653467-45653489 GTGTGTATGTGAAAGTGGCAGGG + Intronic
1160394484 18:78561848-78561870 GGCTGCTTGTGGAAGGGTCCAGG - Intergenic
1161663481 19:5561053-5561075 GTGTGGCTGGGAAAATGTCCTGG + Intergenic
1162993754 19:14320338-14320360 GTGTGCTTGTGAACCTGTTGTGG + Intergenic
1166423134 19:42653657-42653679 GTGTCCTCGTGACAGGGTCCTGG + Intronic
1167635634 19:50653574-50653596 GTGTGTGTGTGAGAGTGTGCAGG + Intronic
925245292 2:2377323-2377345 GTGTGTATGGGAAAGTGTACTGG - Intergenic
926354933 2:12033193-12033215 GTGGCATTGTAAAAGTGTCCTGG + Intergenic
928015984 2:27657551-27657573 CTGTGCTAATGAGAGTGTCCTGG - Exonic
929942214 2:46342964-46342986 TTGTGCATATGAAAATGTCCAGG + Intronic
930629613 2:53737687-53737709 TTGTGTATGTGAAATTGTCCAGG + Intronic
932047700 2:68366094-68366116 GTGTGGTTGTGAAAGCTCCCCGG + Intronic
936773448 2:115942957-115942979 GCGAGCTTGTGAAAGTGTAGGGG + Intergenic
938449333 2:131402745-131402767 TTGTCCTTGTGAAAGTGCACTGG + Intergenic
938744143 2:134261015-134261037 GCGTGCTTGTGAACTTGGCCTGG - Intronic
939294395 2:140240811-140240833 ATGTGCATGTGAAAGTATCAAGG + Intronic
940144158 2:150527813-150527835 CTGTGCTTGTGGAATTGTCAGGG - Intronic
943380215 2:187135426-187135448 GTTTGCTTGAGATAGTTTCCTGG + Intergenic
944912298 2:204322605-204322627 GTGTGCTTGTGGAAGAGTTTTGG - Intergenic
946580292 2:221121075-221121097 GTGTGCTTCTTAGAATGTCCTGG + Intergenic
947100689 2:226618166-226618188 CTGTGCTTGTGTGAGTGTGCTGG - Intergenic
947644158 2:231725981-231726003 GTGAGTTTGTGGAAGTGCCCTGG + Intergenic
948097138 2:235344282-235344304 GTGTGCCTGTGTGAGTGTGCAGG - Intergenic
948229756 2:236341415-236341437 GTGTGTTTGTAAAAGTGGCAGGG + Intronic
948614188 2:239187778-239187800 GTGTGCTTGTTAAAGTGGACAGG + Intronic
948692187 2:239713137-239713159 GTGTGTGTGTGAATGTGTCTGGG + Intergenic
948694035 2:239724021-239724043 GTGTACTTGTGTGAGTGTCCAGG + Intergenic
1171018293 20:21561569-21561591 GTGTCCTTGTGAAGGAGACCAGG + Intergenic
1171143799 20:22764743-22764765 GTGTGCCTGTGAAAGGCTGCAGG + Intergenic
1171373026 20:24673905-24673927 CAATGCTTGTGAAACTGTCCTGG - Intergenic
1175217256 20:57398067-57398089 GTGTGCCTGGGTTAGTGTCCTGG + Intronic
1175927450 20:62477865-62477887 GGGTGCTTGTGGAGGCGTCCAGG + Intergenic
1179648822 21:42793372-42793394 TTCTGCTTGTAAGAGTGTCCAGG - Intergenic
1180009412 21:45040013-45040035 GTGTGCTGGGGGCAGTGTCCTGG + Intergenic
1181304006 22:21904065-21904087 GTGTGCCTGTAAAAATCTCCTGG + Intergenic
1181978862 22:26752202-26752224 GTGTGCTTGAGGAAGAGACCTGG + Intergenic
1182078944 22:27515331-27515353 GCTTGCTTAGGAAAGTGTCCAGG - Intergenic
1184636261 22:45834433-45834455 GTGTGCTACTGGCAGTGTCCCGG + Intronic
949109047 3:236421-236443 GTGTTCTTGAGAATGTGTCTTGG + Intronic
952328621 3:32343197-32343219 GGTTGCTTCTGAATGTGTCCTGG + Intronic
952634944 3:35517894-35517916 GAGAGCTTATGAAAGTGTCTGGG + Intergenic
957600330 3:82325712-82325734 ATGTGATTGTGAAGGTGCCCAGG - Intergenic
957766038 3:84625171-84625193 GTGTTCTTGTCAAAGTGTCTAGG - Intergenic
960638263 3:119804907-119804929 GTGTGCTTGTTGAAATGTCTAGG - Intronic
961487841 3:127229607-127229629 TTGTGCTTATGAAAATGGCCAGG - Intergenic
962250878 3:133835391-133835413 GTGTGTTTGTGTAAGTGTGGGGG + Intronic
963482657 3:145895988-145896010 GTGTGTCTGTGAGAGCGTCCTGG - Intergenic
964728313 3:159838144-159838166 GTGTGCTTGTGAGTGCGTCAAGG + Intronic
967226150 3:187293303-187293325 CTGTGCTTGTAGAAGTGTCCAGG + Intergenic
968933808 4:3599055-3599077 GTGTGCATGTGAATGTGGGCAGG + Intergenic
970338950 4:15084658-15084680 GTGTGGTGATGAAATTGTCCTGG - Intergenic
972866665 4:43241709-43241731 GGGTGCTTGTTAAAGTATTCGGG + Intergenic
972928940 4:44047498-44047520 GTGTGGCTCTGAAAGTGTCTTGG - Intergenic
974269358 4:59630488-59630510 TTATGCTTGTGAAAGTATACTGG - Intergenic
976823870 4:89237489-89237511 GTGCCCTTTTGAAAGTGGCCCGG + Exonic
979033418 4:115680388-115680410 GTGTGCTTGTCAAGGTGTTATGG + Intergenic
981175498 4:141678120-141678142 GTGTGCATGTAAAACTGTGCTGG - Intronic
981599982 4:146476499-146476521 GTGTGCATGTGCATGTGTCTTGG + Intronic
986202135 5:5588389-5588411 GCGTGCTTCTCAAAGTATCCAGG - Intergenic
986803631 5:11286858-11286880 CTGTTCTTGTGCATGTGTCCTGG - Intronic
990081036 5:51913843-51913865 CTGTTCTTGTCAAAGTGGCCTGG + Intergenic
991438401 5:66619524-66619546 GTGTGCTTGTGAATCTATACAGG + Intronic
994039229 5:95238832-95238854 GTGTGCTTGTGTATGTATGCTGG - Intronic
995767723 5:115637020-115637042 CTGTGATTGTAAAAGTGTGCTGG - Intergenic
996135698 5:119839546-119839568 GTGGGCTTGTGAAAGTGTTTTGG + Intergenic
999850162 5:155529061-155529083 ATGTGCTTGTGTAAGTGTAGAGG + Intergenic
1000867031 5:166526520-166526542 GTGTGCTTGGAGAAGTGTCCTGG - Intergenic
1001998951 5:176185335-176185357 TTGTCCTTGTGAAAGTGCACTGG - Intergenic
1002095880 5:176830540-176830562 GTGTGCATGTGCATGTGTCCTGG + Intronic
1003403461 6:5809666-5809688 ATGTGCTTGTGGATGTGTGCAGG + Intergenic
1006715985 6:36120984-36121006 GGGTGCTGGTGAGAGTGGCCTGG + Intergenic
1009324487 6:62333155-62333177 TTGTGCTTCTGAAATTGTCTAGG + Intergenic
1011156780 6:84341834-84341856 GTGTGTGTGTGTATGTGTCCTGG + Intergenic
1011407606 6:87031969-87031991 AAGTGCTTGTCAAAGTGTCTGGG - Intergenic
1011787547 6:90863957-90863979 GTATGTTTTTGAAAGTTTCCTGG - Intergenic
1015577958 6:134692754-134692776 GTGTGTTTGTGTATGTGTCAGGG - Intergenic
1022165109 7:27751758-27751780 GTATGCTTGAGAAAGTGTTAAGG + Intronic
1022846175 7:34212282-34212304 GTGTGCATGTGGAAGTGTGGAGG - Intergenic
1026014550 7:66662723-66662745 GTGTGCAGGTGTAAGTGTGCAGG + Intronic
1027217829 7:76195482-76195504 GTGGACTTGGGAAAGTCTCCTGG - Intergenic
1027584328 7:80039012-80039034 CTGTGCTTTTAAAAGTGTTCAGG + Intergenic
1027654893 7:80918711-80918733 GTGTTCTTAAGAAAATGTCCAGG + Intronic
1029737221 7:102471669-102471691 GTCTGCTTGGAGAAGTGTCCCGG - Intronic
1032945764 7:136850617-136850639 ATTTGCTTGTGTAAGTGACCAGG - Intergenic
1033898709 7:146109375-146109397 GTGTCCTTATGAAAGTGGCCTGG + Intergenic
1035390682 7:158502438-158502460 GTGTGGTTGTGACAGTGTTCTGG - Intronic
1036076891 8:5512330-5512352 GTGTGAGTGTGAAAGTGTGTGGG + Intergenic
1036998581 8:13689431-13689453 GTCTGCTTGTCAAAGAGTCTGGG + Intergenic
1038665274 8:29532183-29532205 GTGGGCTTGTGAAAGTCAACTGG - Intergenic
1038752274 8:30306364-30306386 GTGTGCCTGGCAAAGTCTCCTGG + Intergenic
1042889413 8:73590663-73590685 GTGTGCTTGGTAAGGTGTCCAGG - Intronic
1043780182 8:84324069-84324091 GTGTGTTTGTGATAGTGTGTGGG + Intronic
1045839651 8:106564400-106564422 GTGTGTGTGTGTATGTGTCCAGG - Intronic
1046806032 8:118479859-118479881 GAGGGCCTGTGATAGTGTCCAGG - Intronic
1046891792 8:119430235-119430257 GTGTGCTTCTGGAATTGTCCAGG - Intergenic
1046984111 8:120368766-120368788 GTATGAGTGTGAAATTGTCCTGG - Intronic
1047263063 8:123279635-123279657 GGCTGCTTGTGAATGAGTCCAGG - Intergenic
1047746087 8:127846060-127846082 GTGTGCTTGGGAAAGGCTCCAGG - Intergenic
1049056269 8:140239630-140239652 GTGTGTTGGTGTAGGTGTCCAGG - Intronic
1049535995 8:143182588-143182610 GTGTGCATGTGAGTGTGTCTGGG + Intergenic
1050676581 9:8062662-8062684 GGGTGCTTGTGAATGTGTGGTGG + Intergenic
1054716360 9:68560812-68560834 GTGTGCTGTGGAAAGTGACCTGG - Intergenic
1055195591 9:73589088-73589110 CTGTGCTTGTGAAACTGTAGAGG + Intergenic
1055381998 9:75717522-75717544 GTGTGCATGTGTATGTGTCGAGG - Intergenic
1055467755 9:76582396-76582418 GTGTGATGGAGAAAGTGTCCAGG + Intergenic
1055773359 9:79740882-79740904 ATGGGCATGTTAAAGTGTCCAGG + Intergenic
1056304045 9:85271585-85271607 GTATTCTTGTGAAAGTCTGCGGG - Intergenic
1057971721 9:99565121-99565143 GTGTACTTGTGAAAGTGCTTAGG - Intergenic
1059962942 9:119584476-119584498 GTTTGCTTGGGAAAGGCTCCTGG + Intergenic
1187730653 X:22250569-22250591 TTGTGTTTGTGAAAATCTCCTGG + Exonic
1188722732 X:33543433-33543455 GTGAGCCTGTGGCAGTGTCCCGG + Intergenic
1191975195 X:66863878-66863900 CAGTGTTTGTGAAAGTGACCTGG - Intergenic
1192195705 X:69026554-69026576 GTGTGTTTGTGTAAGTGACTGGG + Intergenic
1196604876 X:117645841-117645863 TTGTCCTTGTCAAAATGTCCTGG - Intergenic
1198574022 X:137990380-137990402 AAGTGCTGGTGAAAGTGTTCAGG - Intergenic
1201303705 Y:12532866-12532888 ATCTGCTTCTGAAAATGTCCTGG - Intergenic
1201532102 Y:15002795-15002817 GTGTGTGTGTGTAATTGTCCTGG - Intergenic