ID: 900199991

View in Genome Browser
Species Human (GRCh38)
Location 1:1400161-1400183
Sequence GTCTCACGCCCTGCCCGTCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 128}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900199988_900199991 -10 Left 900199988 1:1400148-1400170 CCTCCCGCAGGCGGTCTCACGCC 0: 1
1: 0
2: 0
3: 4
4: 57
Right 900199991 1:1400161-1400183 GTCTCACGCCCTGCCCGTCCTGG 0: 1
1: 0
2: 1
3: 11
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900199991 Original CRISPR GTCTCACGCCCTGCCCGTCC TGG Exonic
900199991 1:1400161-1400183 GTCTCACGCCCTGCCCGTCCTGG + Exonic
900626333 1:3610365-3610387 GTCTGACAGCCTCCCCGTCCAGG - Intronic
901875929 1:12167148-12167170 GGCGCACGCCTTGCCCGCCCAGG + Exonic
902044324 1:13513707-13513729 GGCGCACGCCCTCCCCGCCCGGG - Exonic
904252920 1:29237631-29237653 GCCTCGGGCCCTGCCCGACCCGG - Intronic
905179252 1:36156315-36156337 GCATCACGCCCGGCCCGGCCCGG - Exonic
912724249 1:112044609-112044631 GTCTCAGGCACTGCTCTTCCTGG - Intergenic
915727171 1:158026013-158026035 GCCTCTCTCCCTGCCAGTCCTGG + Intronic
922193470 1:223339829-223339851 GCCTCAGGCCCAGCCAGTCCTGG - Intronic
922724314 1:227915357-227915379 GACTCACTCCCTGCCCCACCTGG - Intergenic
1062844690 10:695380-695402 GTCTCAGGTCCTTGCCGTCCTGG + Intergenic
1075778317 10:125001980-125002002 ATCTGACACCCAGCCCGTCCCGG + Intronic
1076706464 10:132304777-132304799 GCCTCACTGCCTGCCCGGCCCGG + Intronic
1076796894 10:132802844-132802866 GTCTCAGGCCCTGTCCCTGCAGG + Intergenic
1077500566 11:2908145-2908167 CTCCCACCCCCTGCCCATCCAGG + Intronic
1077540329 11:3143643-3143665 GTGTCCAGACCTGCCCGTCCTGG - Intronic
1078055170 11:8003387-8003409 GTCCCACCACCTGCCCGACCTGG + Intergenic
1082270416 11:50164173-50164195 GTCTCAAGCCCTGCCACACCGGG + Intergenic
1084163658 11:67364995-67365017 ATCACACGCCCAGCCGGTCCAGG + Exonic
1086395330 11:86409680-86409702 GTCTCATGATCTGCCCGTCTTGG + Intronic
1087683781 11:101241378-101241400 GTCTCAAGCCCTGCCCCACCGGG + Intergenic
1089208876 11:116787751-116787773 GTCTGACCCCCGGCTCGTCCCGG + Intronic
1101615298 12:106330424-106330446 GCCTCCCGCCCTGCCCTGCCAGG - Intronic
1104020561 12:124989213-124989235 GTCCCGCCCCCTGCCCGGCCCGG - Intergenic
1104718873 12:131033656-131033678 GGCCCACGGCCTGCCCCTCCAGG - Intronic
1104919985 12:132285664-132285686 GTGTCAGGCCCTGCCAGCCCTGG - Intronic
1108750078 13:53439751-53439773 GTCCCAAGCCCTGCCCCGCCAGG - Intergenic
1112282672 13:98076464-98076486 GTCCCAAGCCCTGCCCCGCCAGG + Intergenic
1113885982 13:113658577-113658599 GCCTCACGCCCTCCCAGGCCAGG - Intergenic
1117944063 14:60998853-60998875 GTCGCAGGCCCTGCCCTTCGTGG + Intronic
1121008749 14:90507550-90507572 GGCTGACCACCTGCCCGTCCTGG + Intergenic
1126786322 15:52180111-52180133 GTCACACTCCCTGCCTCTCCCGG - Intronic
1127262939 15:57339068-57339090 ATCTCACGCCCTGCTCCTCTGGG + Intergenic
1130133122 15:81160282-81160304 GTCCCATGCACTGTCCGTCCGGG - Intronic
1132339165 15:101067173-101067195 GTCTCAGCTCCTGCCCTTCCTGG + Intronic
1132458835 16:39348-39370 GCCTCACGGCCTGCCTGCCCTGG + Intergenic
1132648486 16:1009941-1009963 CTCCCACGCCCAGCCCCTCCTGG - Intergenic
1132704224 16:1235820-1235842 GTGTGACTCCCTGCCCGGCCGGG + Intergenic
1132707294 16:1250605-1250627 GTGTGACTCCCTGCCCGGCCGGG - Intergenic
1133232756 16:4374224-4374246 GGCTGAGGCCCTGCCCCTCCTGG - Intronic
1135620879 16:23954425-23954447 GGCTCTTGCCCTTCCCGTCCTGG + Intronic
1138327952 16:56191297-56191319 GCCCCGCGCCCTCCCCGTCCCGG + Intergenic
1139330715 16:66187705-66187727 GTCTCAAGGCCTGTCTGTCCTGG - Intergenic
1142762481 17:2050430-2050452 GTCTCCCGCCCTGCCCCGCCCGG + Intergenic
1148646965 17:49224794-49224816 GCCGCACGCCCTGCTCGCCCAGG + Exonic
1148751459 17:49947842-49947864 ACCTCTCGCCCTGCCCCTCCAGG - Intergenic
1151749310 17:76027582-76027604 GTCTCCAGCCCTGTCTGTCCTGG - Intergenic
1152070536 17:78131827-78131849 GTCACCCGCCCTGCCCACCCGGG - Intronic
1152233943 17:79128740-79128762 GTCTCCTGAGCTGCCCGTCCTGG - Intronic
1152381261 17:79943401-79943423 GCCCTACGCCCTGCCTGTCCTGG - Intronic
1152404120 17:80086853-80086875 GCCTCTCGCCCTGCCCTTCTTGG + Intronic
1152460169 17:80438368-80438390 GTCACACGCCCTTCCCCTGCAGG + Intergenic
1152823729 17:82450559-82450581 GTGTCCCGCCGTGCCCGTCGCGG - Exonic
1152962769 18:89597-89619 GCCTCACGGCCTGCCTGCCCTGG + Intergenic
1158976427 18:62715445-62715467 GACACACGCCCTCCCCGCCCGGG - Exonic
1159927661 18:74283181-74283203 ATCTCTCGCCCTCCCCTTCCGGG - Intronic
1160996369 19:1883935-1883957 ATCTCACACCCTGCCACTCCTGG + Intronic
1161045629 19:2132898-2132920 GTCCCCAGCCCTGCCCATCCAGG - Intronic
1161405766 19:4090417-4090439 GTCTCCTCTCCTGCCCGTCCTGG - Exonic
1161576422 19:5056920-5056942 GTCTAGAGCCCTGCCTGTCCCGG + Intronic
1163028318 19:14527087-14527109 GCCTCACTCCCTGCCCTTCTTGG - Intronic
1163304993 19:16472136-16472158 GCCTCAGGCCCAGCCCCTCCAGG - Intergenic
1165008029 19:32822512-32822534 ACCTCACGATCTGCCCGTCCTGG - Intronic
1165073778 19:33269758-33269780 GTCTACCTCCCTGCCCATCCAGG + Intergenic
1166098310 19:40555209-40555231 GTCTCACGCCCCTCCTATCCAGG - Intronic
1166751626 19:45166597-45166619 GCCTCACGCCCCAGCCGTCCTGG - Intronic
927200487 2:20575294-20575316 GTCCCTAGCCCTGCCTGTCCAGG - Intronic
927472410 2:23385856-23385878 CTCCCACGCCCGGCCCGGCCCGG - Intronic
934618265 2:95788794-95788816 CTCCCACACCCTGCCCCTCCGGG - Intergenic
934642628 2:96035765-96035787 CTCCCACACCCTGCCCCTCCGGG + Intronic
935142702 2:100368038-100368060 ATCTCATGCCCTGCCCCTCCTGG - Intergenic
937207177 2:120244298-120244320 GGCTCAGGCCCAGCCCGTCCCGG + Intronic
937299556 2:120830730-120830752 GTGAGACTCCCTGCCCGTCCTGG + Intronic
937870276 2:126781410-126781432 GTCCCAGGTCCTGCCTGTCCCGG - Intergenic
940857418 2:158740280-158740302 GTCTCAGGCCCTTCCAGTCCTGG - Intergenic
948982459 2:241501323-241501345 GGCTCACACCCTGCCTGCCCAGG + Intronic
949045048 2:241868760-241868782 GTCTCCGCCCCTGCACGTCCCGG + Intergenic
1174483910 20:50849498-50849520 ATCTCACACCCTGCCTGTCCTGG - Intronic
1175800714 20:61799747-61799769 GGCCCACGCCCTGCCCACCCAGG - Intronic
1175858077 20:62133442-62133464 CCCTCACACCCTGCCAGTCCCGG - Exonic
1179881451 21:44294873-44294895 GTCTCACCCCCAGCCCTCCCTGG + Intronic
1180216217 21:46324958-46324980 GGCTCGCGTCCTGCCCGTCCGGG + Intronic
1181689374 22:24549935-24549957 GTCTCACACCCTGGTGGTCCTGG - Intronic
1183581138 22:38727355-38727377 GTCTAAGGCCCTGCCAGCCCAGG + Intronic
1184412084 22:44331460-44331482 GGCCCCCGCCCTGCCCGCCCCGG + Intergenic
951323179 3:21271750-21271772 GTCCCACGCCCTGCCCCGCGGGG + Intergenic
951551859 3:23882664-23882686 GTCTCAAGCCCTGCCCCACGGGG + Intronic
953947836 3:47164253-47164275 GTGTTCCGCTCTGCCCGTCCCGG - Intergenic
956459253 3:69454669-69454691 GTCCCAAGCCCTGCCCCTCGGGG - Intronic
957154620 3:76532054-76532076 CTCTTACGCCCTGCCTCTCCTGG + Intronic
961491650 3:127260621-127260643 GTCCCAGGCCCTGCCCACCCAGG - Intergenic
962313808 3:134345444-134345466 GCCTCAGGCCCTTCCCTTCCAGG - Intergenic
963051531 3:141147718-141147740 GCCTGACGCCGTGCCCCTCCTGG + Exonic
963554684 3:146772577-146772599 GTCGCAAGCCCTGCCCGGCGGGG - Intergenic
964198168 3:154088201-154088223 GTCCCACGCCCTGCCCTACAGGG - Intergenic
968562475 4:1291559-1291581 GTCTCACGCAGTGCACCTCCAGG + Intronic
979867957 4:125779257-125779279 GTCTCAGGCTCTTCCCGTCCTGG - Intergenic
985168912 4:187127595-187127617 CTCTCACGACCTGCCCCTGCTGG + Intergenic
986274813 5:6264477-6264499 GTCTCACGCCTTCCTCTTCCAGG - Intergenic
988291738 5:29296616-29296638 GTCCCAAGCCCTGCCCCTCAGGG + Intergenic
997090340 5:130849204-130849226 CTCTCACTCCCTTCCGGTCCTGG + Intergenic
998665458 5:144292178-144292200 CTCACAGGCCCTGCCCCTCCTGG - Intronic
999698570 5:154207576-154207598 CTTACCCGCCCTGCCCGTCCGGG - Intronic
1001310471 5:170606636-170606658 GTCTCACGGCCTGCCCCTCCCGG - Intronic
1001382885 5:171315550-171315572 GCCTCACTCCCTGCCCGGACCGG - Intergenic
1001577053 5:172771317-172771339 GTCACCCGCCCTGCCAGGCCAGG + Intergenic
1002056071 5:176598504-176598526 GACACACGCTCTGCCTGTCCAGG + Exonic
1002168707 5:177363305-177363327 GTCTCCGGCCCCGCCCCTCCTGG - Intronic
1004150950 6:13119677-13119699 CTCTCAGGCCCTGCCCTTCAGGG - Intronic
1004418254 6:15444974-15444996 GTGTCACGCCATGCCCTTCTTGG + Intronic
1006072309 6:31506723-31506745 GCCTCCCGGCCTGCCCATCCCGG + Intronic
1006111689 6:31750569-31750591 GACTCACGCCCTGCTCGTACTGG - Intronic
1012439944 6:99253512-99253534 CTCTCCAGCCCTGCCCCTCCAGG + Intergenic
1018551316 6:165001754-165001776 GTCCCAAGCCCTGCCCGTCAGGG + Intergenic
1019368956 7:650857-650879 GCCTCCCTCCCTGCCCGTGCTGG + Intronic
1019421691 7:953930-953952 GCCTCACGCCCTTCCCGCACCGG - Intronic
1026098312 7:67364651-67364673 GTCCCGAGCCCTGCCCGGCCGGG + Intergenic
1029000888 7:97152895-97152917 GTCTCCCGCCATGCCCGCCATGG + Intronic
1032312775 7:130803636-130803658 GCCTCACCCCCAGCCTGTCCAGG - Intergenic
1034944710 7:155254367-155254389 GCCAAACGCCCTGCCCGCCCTGG + Intergenic
1035163460 7:156968324-156968346 GCCCCCCGCCCTGCCCCTCCGGG + Intronic
1035600002 8:891777-891799 CTCCCAGGCCCTCCCCGTCCTGG - Intergenic
1035792217 8:2317373-2317395 GCCTCACGCCCTGTTCCTCCGGG - Intergenic
1035800588 8:2404332-2404354 GCCTCACGCCCTGTTCCTCCGGG + Intergenic
1042336049 8:67630956-67630978 GTCCCAAGCCCTGCCCCTCGGGG - Intronic
1043731923 8:83694125-83694147 GTCCCAAGCCCTGCCCCGCCGGG + Intergenic
1045367970 8:101493752-101493774 GGCTCGCGTCCTTCCCGTCCCGG + Intronic
1045743319 8:105387457-105387479 GTCCCAAGCCCTGCCCCGCCGGG + Intronic
1049399535 8:142418757-142418779 GTGTCCTGCCCTGCCCGCCCAGG + Intergenic
1051474256 9:17486313-17486335 TTCTCACGCCCTTCCCTTCTTGG + Intronic
1057180222 9:93025863-93025885 TTCTCAGGCACTGCCCCTCCTGG + Intronic
1057314711 9:93960824-93960846 GTCTCAGGCTCTGCACGTCGGGG - Intergenic
1057430226 9:94987366-94987388 GTCACACTCCCTGCCCGTAAGGG - Intronic
1058309530 9:103483945-103483967 GTCCCAAGCCCTGCCCGGCAGGG - Intergenic
1060518468 9:124280353-124280375 GTCTGACGCCGTACCCTTCCAGG - Intronic
1061304310 9:129723591-129723613 GTATCCCGCCCTGCCCATGCAGG + Intergenic
1062285618 9:135771303-135771325 GTCTCCTGCCCTGCCCGGTCTGG - Intronic
1062323434 9:136001582-136001604 GCCGCACGCCCTGCCCCGCCTGG + Intergenic
1062440948 9:136568989-136569011 GTGTCACACCCTCCCAGTCCCGG - Intergenic
1062500440 9:136849775-136849797 GTGTCACGCCCTTCCCGCCCAGG - Intronic
1192330920 X:70174664-70174686 GTCTCTTGGACTGCCCGTCCAGG + Intergenic