ID: 900201290

View in Genome Browser
Species Human (GRCh38)
Location 1:1407780-1407802
Sequence GGCCGCGGCGAGCCGAGGTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 346
Summary {0: 1, 1: 0, 2: 1, 3: 39, 4: 305}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900201290_900201296 -2 Left 900201290 1:1407780-1407802 CCCGACCTCGGCTCGCCGCGGCC 0: 1
1: 0
2: 1
3: 39
4: 305
Right 900201296 1:1407801-1407823 CCTCTGCCTTCCTAGTAGCTGGG 0: 2
1: 464
2: 17137
3: 229632
4: 284772
900201290_900201294 -3 Left 900201290 1:1407780-1407802 CCCGACCTCGGCTCGCCGCGGCC 0: 1
1: 0
2: 1
3: 39
4: 305
Right 900201294 1:1407800-1407822 GCCTCTGCCTTCCTAGTAGCTGG 0: 1
1: 337
2: 14399
3: 208928
4: 266407
900201290_900201300 25 Left 900201290 1:1407780-1407802 CCCGACCTCGGCTCGCCGCGGCC 0: 1
1: 0
2: 1
3: 39
4: 305
Right 900201300 1:1407828-1407850 CAGGCGCGCGCCGCCACGCCCGG 0: 13
1: 399
2: 13415
3: 62555
4: 162562
900201290_900201298 6 Left 900201290 1:1407780-1407802 CCCGACCTCGGCTCGCCGCGGCC 0: 1
1: 0
2: 1
3: 39
4: 305
Right 900201298 1:1407809-1407831 TTCCTAGTAGCTGGGACGTCAGG 0: 1
1: 4
2: 262
3: 9003
4: 136039

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900201290 Original CRISPR GGCCGCGGCGAGCCGAGGTC GGG (reversed) Intergenic
900201290 1:1407780-1407802 GGCCGCGGCGAGCCGAGGTCGGG - Intergenic
900240785 1:1616270-1616292 GGCCGCGGCTCGCAGACGTCAGG - Intronic
900313405 1:2045475-2045497 GGCTGCAGCGAGCCGAGATATGG + Intergenic
901581093 1:10244375-10244397 GGTTGCGGTGAGCCGAGATCGGG - Intronic
901607676 1:10472243-10472265 GGCGGGGGCGAGGCGGGGTCAGG - Intronic
902323599 1:15684385-15684407 GGCCCAGGCGAGGCGAGGGCCGG + Exonic
902855714 1:19203016-19203038 GGCTGCAGTGAGCCGAGATCGGG + Intronic
903881532 1:26513446-26513468 GGCTGCGGTGAGCCGAGATCGGG - Intergenic
904022806 1:27480777-27480799 GGCCGAGGCGGGTGGAGGTCAGG + Intronic
904827156 1:33281004-33281026 GGCTGCAGTGAGCCGAGGTCGGG + Intronic
905735881 1:40325520-40325542 GGTTGCGGTGAGCCGAGATCGGG - Intergenic
906240144 1:44237884-44237906 GGCCGCCGGGAGCCAAGGCCAGG - Intronic
906430417 1:45751371-45751393 GGTTGCGGTGAGCCGAGATCCGG - Intergenic
906532825 1:46533221-46533243 GGCCGCGGCGGGCCCGGGCCAGG - Intergenic
906545505 1:46616865-46616887 GGCCGCGGCGTGGCGGGGCCGGG - Intronic
907070566 1:51530909-51530931 GGCTGCAGTGAGCCGAGATCAGG + Intergenic
907101555 1:51842108-51842130 GGCTGCAGCGAGCCCAGATCGGG + Intronic
908780366 1:67685252-67685274 GCCCGTGGCGAGGCGAGGTCCGG + Exonic
914817701 1:151075199-151075221 GGCTGAGGCGGGCAGAGGTCAGG + Intronic
915594880 1:156891112-156891134 GGCCGAGGCAGGCAGAGGTCGGG - Intergenic
916044751 1:160991065-160991087 GGTTGTGGTGAGCCGAGGTCTGG + Intergenic
916729566 1:167553792-167553814 GGCCTGGGCGCGCCGAGCTCCGG - Intergenic
918296146 1:183159360-183159382 GGCTGCAGTGAGCCGAGATCGGG - Intergenic
918417982 1:184332007-184332029 GGCTGCAGTGAGCCGAGATCAGG + Intergenic
918436669 1:184521118-184521140 GGCCGAGGCGAGTGGAGGTCAGG - Intronic
918487560 1:185045611-185045633 GGCCGCGGCCAGCGGAGCCCTGG + Exonic
920887007 1:209938580-209938602 GGCCGCGCGGAGTGGAGGTCGGG + Intronic
923008045 1:230067505-230067527 GGGCGACGCGAGCGGAGGTCCGG - Intronic
923773675 1:236959713-236959735 GGCAGAGGTGGGCCGAGGTCAGG - Intergenic
924188221 1:241519291-241519313 GTCCGTGGCGGGCCGAGGCCGGG - Intronic
924332966 1:242958288-242958310 GGTCGCAGTGAGCCGAGATCAGG + Intergenic
924638236 1:245808988-245809010 GGCCGAGGCGGGCGGAGGTCAGG - Intronic
1063929987 10:11018536-11018558 GGGCGCGGCGTCCCGGGGTCCGG + Intronic
1064011849 10:11742282-11742304 GGGAGCGGCGAGCCGGGGGCGGG + Intergenic
1064034000 10:11900792-11900814 GGCTGCAGTGAGCCGAGATCGGG + Intergenic
1067121282 10:43474224-43474246 GGCTGAGGTGGGCCGAGGTCAGG + Intronic
1069508223 10:69020652-69020674 GGCCGAGGCGGGCAGAGGTCAGG + Intergenic
1070259545 10:74841336-74841358 GGCCGAGGTGGGCTGAGGTCAGG + Intronic
1071532434 10:86400481-86400503 GGCGGCGGCGAGCCGAGACCAGG - Intergenic
1072248680 10:93565239-93565261 GGTTGCGGTGAGCCGAGATCAGG - Intergenic
1076992050 11:280506-280528 GGCACCGGCGCGCCGCGGTCGGG - Exonic
1077632723 11:3821993-3822015 GGCTGCAGTGAGCCGAGATCGGG + Intronic
1078937122 11:15961768-15961790 GGCCGAGGCGGGCTGAGGTCAGG - Intergenic
1081613823 11:44578992-44579014 AGCCGCTGCCAGCTGAGGTCAGG + Intronic
1082743623 11:56938810-56938832 GGTTGCAGTGAGCCGAGGTCGGG - Intergenic
1083312747 11:61793083-61793105 GGCCGTGGGGAGCCGGGGTCTGG + Intronic
1083879059 11:65539390-65539412 GGCCGCTGCGTGCCGCGGCCGGG - Exonic
1083927669 11:65818286-65818308 GGGAGCGGCGATCCGAGGCCGGG + Intergenic
1083970206 11:66070048-66070070 GGCCGCGGCCGGCCGTGGGCGGG + Intergenic
1084295924 11:68213415-68213437 GGGCGCAGCGAGCCGAGGCCGGG - Exonic
1084406288 11:68975762-68975784 GGTTGCGGTGAGCCGAGATCAGG - Intergenic
1084946697 11:72642494-72642516 GGCCGGGGCGGGCCGGGGGCGGG - Intronic
1088055502 11:105571586-105571608 GGTTGCAGTGAGCCGAGGTCGGG - Intergenic
1089477739 11:118779091-118779113 GGCTGCAGTGAGCCGAGATCAGG + Intronic
1089964374 11:122643682-122643704 GGTTGCAGTGAGCCGAGGTCAGG + Intergenic
1090087813 11:123666264-123666286 GGCTGCAGCGAGCTGAGATCAGG + Intergenic
1090326398 11:125889672-125889694 GGTTGCGGTGAGCCGAGATCAGG + Intronic
1091550333 12:1531095-1531117 GGTCGGGGCGGGCCGGGGTCAGG + Intronic
1092101742 12:5889267-5889289 GGCCTCGGCCAGCCCAGGTAGGG + Intronic
1093387078 12:18570269-18570291 GGTTGCGGTGAGCCGAGATCAGG - Intronic
1093996755 12:25651384-25651406 GGTTGCGGTGAGCCGAGATCGGG - Intergenic
1096300642 12:50424419-50424441 GGTTGCGGTGAGCCGAGATCGGG - Intronic
1096529331 12:52233371-52233393 CGCCGGGGCGAGCGGAGCTCAGG - Exonic
1097005781 12:55916733-55916755 TGTTGCGGTGAGCCGAGGTCAGG + Intronic
1098991169 12:77065824-77065846 GGCCGCGGGAAGCCAAGGTGGGG + Intergenic
1099915374 12:88885901-88885923 GGTTGCGGTGAGCCGAGATCAGG + Intergenic
1100488593 12:95055888-95055910 GGCTGCAGTGAGCCGAGATCGGG + Intronic
1100963054 12:99984696-99984718 AGCCGAGGCGAGCCCGGGTCGGG - Intergenic
1102272532 12:111549997-111550019 GGTTGCGGTGAGCCGAGATCAGG + Intronic
1103359240 12:120343917-120343939 GGCTGCAGTGAGCCGAGATCAGG - Intronic
1103979143 12:124725010-124725032 GGCCGAGGCGGGCGGAGGTCGGG - Intergenic
1104717618 12:131026454-131026476 GACCGCGTGGAGCCGAGCTCCGG + Intronic
1104733548 12:131122211-131122233 GGGCGCCACGAGCCGAGGGCAGG + Intronic
1105063904 12:133179912-133179934 GGTTGCGGTGAGCCGAGATCGGG + Intronic
1107058436 13:36131013-36131035 AGCCGCGGGGCGCCGAGGGCAGG - Intronic
1107472324 13:40702461-40702483 GGCCGAGGTGGGCAGAGGTCAGG + Intergenic
1108040142 13:46332362-46332384 GGCTGCAGTGAGCCGAGATCAGG + Intergenic
1112250457 13:97774523-97774545 GGCTGCAGCGAGCTGAGATCAGG - Intergenic
1112733671 13:102394640-102394662 GCCCCCGGCGAGCCGAGGCTGGG + Intronic
1114545575 14:23497901-23497923 GGTTGCGGTGAGCCGAGATCGGG + Intronic
1116457276 14:45134235-45134257 GGCCGCGGGAAGACGAGGGCGGG + Intronic
1116657929 14:47674751-47674773 GGCGGCGGCGAGCGGAGCGCAGG + Exonic
1117478214 14:56118440-56118462 GGCCGCGGCGCGCGGAGCTCCGG + Exonic
1117680680 14:58200076-58200098 GGCCGCGGCGCGCCGGGCCCGGG - Intronic
1117698361 14:58389118-58389140 GGTTGCAGCGAGCCGAGATCAGG + Intergenic
1117784881 14:59272512-59272534 GGTTGCAGTGAGCCGAGGTCGGG + Intronic
1118030318 14:61812512-61812534 GGACGCGGCGAGGCGAGGAGGGG + Intergenic
1118809012 14:69260399-69260421 GGCCGGGGCGCGCAGAGGGCAGG + Exonic
1118856119 14:69624513-69624535 GGTTGCGGTGAGCCGAGATCAGG - Intronic
1119441511 14:74631595-74631617 GGCAGGGGAGAGCCGAGGGCTGG + Intergenic
1122265793 14:100546342-100546364 GGCCGGGGCGGGGCGAGGGCCGG - Intronic
1122265802 14:100546359-100546381 GGCCGGGGCGGGGCGAGGGCCGG - Intronic
1122265811 14:100546376-100546398 GGCCGGGGCGGGGCGAGGGCCGG - Intronic
1122265820 14:100546393-100546415 GGCCGGGGCGGGGCGAGGGCCGG - Intronic
1122265829 14:100546410-100546432 GGCCGGGGCGGGGCGAGGGCCGG - Intronic
1122265838 14:100546427-100546449 GGCCGGGGCGGGGCGAGGGCCGG - Intronic
1122265847 14:100546444-100546466 GGCCGGGGCGGGGCGAGGGCCGG - Intronic
1122265856 14:100546461-100546483 GGCCGGGGCGGGGCGAGGGCCGG - Intronic
1122695340 14:103549610-103549632 GGCCGCTGCGGGGCAAGGTCAGG - Intergenic
1122975380 14:105168714-105168736 GGGCGCGCAGAGCCGAGGCCGGG - Exonic
1123134303 14:106012834-106012856 GGTTGCGGTGAGCCGAGATCGGG - Intergenic
1123142904 14:106098672-106098694 GGCTGCAGTGAGCCGAGATCAGG - Intergenic
1124253327 15:28121880-28121902 GGCAGTGGCGATCCAAGGTCCGG - Intronic
1124253343 15:28121945-28121967 GGCAGTGGCGATCCAAGGTCCGG - Intronic
1124253359 15:28122010-28122032 GGCAGTGGCGATCCAAGGTCCGG - Intronic
1124564789 15:30803162-30803184 GGCTGCGGGGAGCCGAGACCGGG + Intergenic
1125674188 15:41493872-41493894 GCCCGCGGCGCGCCGGGGACTGG - Exonic
1127486914 15:59427171-59427193 GGCTGCAGTGAGCCGAGATCAGG - Intronic
1127794271 15:62425013-62425035 GGCTGCAGTGAGCCGAGATCAGG - Intronic
1127934352 15:63622388-63622410 GGCTGCAGTGAGCCGAGATCAGG - Intronic
1128149058 15:65350357-65350379 GGCTGAGGCGGGCTGAGGTCAGG - Intronic
1128594635 15:68932451-68932473 GGTTGCGGTGAGCCGAGATCGGG - Intronic
1131116763 15:89800786-89800808 GGCCGAGGCGACCTGGGGTCAGG - Intronic
1132059770 15:98682608-98682630 GGCTGCAGTGAGCCGAGATCAGG - Intronic
1132651070 16:1021672-1021694 GGACGAGGAGAGCCGAGGACGGG + Intergenic
1132778738 16:1611434-1611456 GACTGCAGCGAGCCGAGATCGGG + Intronic
1133105008 16:3501705-3501727 GGTTGCGGTGAGCCGAGATCGGG + Intronic
1133156544 16:3880392-3880414 GGCGGCGGCGGGCCGCGGGCCGG - Exonic
1134442391 16:14307070-14307092 GGCCTCGGCTGGCAGAGGTCTGG - Intergenic
1134457169 16:14403264-14403286 GGCCGAGGCCACCTGAGGTCAGG + Intergenic
1136037694 16:27552755-27552777 GGTTGCGGTGAGCCGAGATCAGG - Intronic
1136503524 16:30687287-30687309 GGTTGCAGTGAGCCGAGGTCAGG + Intergenic
1137614179 16:49837177-49837199 GGCCCTGGCGAGCTGAGGCCTGG + Intronic
1138003776 16:53310786-53310808 GGTTGCAGTGAGCCGAGGTCGGG + Intronic
1138610898 16:58123220-58123242 GGCCAAGGCGAGCTGAGGTCAGG - Intronic
1140442640 16:74999309-74999331 GGCGGCGGCGAGCGGCGGGCGGG - Exonic
1140907005 16:79417587-79417609 GGCTGGGGCGAGCAGAGGTTTGG + Intergenic
1141531233 16:84648457-84648479 GGCCGCGGGGAGGCGGGGCCGGG - Intergenic
1142623733 17:1179941-1179963 GGCCGCGCCGAGCCCAGCTGCGG + Intronic
1143183602 17:4998213-4998235 GGGGGCGGGGAGCCGGGGTCCGG + Intronic
1143543553 17:7583231-7583253 GGGGGAGGCGAGCCCAGGTCGGG - Intergenic
1145830714 17:27914068-27914090 GGTTGCGGTGAGCCGAGATCAGG - Intergenic
1146445350 17:32928264-32928286 GGCCGCGGCGAGTCGGGGAAGGG + Intronic
1147123713 17:38351965-38351987 GGCCGCGGCGGGCGGGGCTCCGG + Intergenic
1147401603 17:40183580-40183602 GGTTGCAGTGAGCCGAGGTCAGG - Intronic
1147954683 17:44125828-44125850 GGTTGCAGCGAGCCGAGATCGGG + Intergenic
1148755680 17:49971880-49971902 GACCGCGGCTGGCCGAGGGCGGG + Intronic
1149175495 17:53865896-53865918 GGCCGAGGTGGGCCGAGGTCAGG + Intergenic
1149595784 17:57863771-57863793 GGCTGAGGCGGGCCGAGGTCAGG + Intronic
1149611171 17:57958624-57958646 GGCCATGGCGGGCGGAGGTCGGG - Intergenic
1149833981 17:59895693-59895715 GGCTGCAGTGAGCCGAGATCAGG - Intronic
1150326481 17:64262623-64262645 GGCGGCGGCGTGCCGAAATCCGG - Intronic
1150381422 17:64723246-64723268 GGCCGCAGTGAGCCGAGATCAGG + Intergenic
1150548906 17:66191614-66191636 GGCCTCGGCGGGCCGAGGAAGGG - Intronic
1150562350 17:66303935-66303957 GGCTGCAGTGAGCCGAGATCGGG + Intronic
1150778646 17:68101579-68101601 GGCCGCGGCGGCCTCAGGTCCGG + Intergenic
1152721911 17:81927536-81927558 GGGCCCGGCGGGCCGAGGCCGGG + Exonic
1153238769 18:3012880-3012902 GGTCGCGGCGAGGCGGGGACTGG + Intronic
1154197593 18:12278012-12278034 GGCAGCAGTGAGCCGAGATCAGG - Intergenic
1154485640 18:14869895-14869917 GGTTGCGGTGAGCCAAGGTCAGG - Intergenic
1155552010 18:26974734-26974756 GGTTGCGGTGAGCCGAGATCGGG - Intronic
1155928808 18:31685094-31685116 GGCCGCGGGGCGCCGGGGCCCGG - Intronic
1160511252 18:79454748-79454770 GGCTGTGGGGAGCCGAGGGCCGG + Intronic
1160935490 19:1592675-1592697 GGCGGCGGCGAGTGGGGGTCCGG - Exonic
1161305433 19:3564728-3564750 GGTTGCAGTGAGCCGAGGTCTGG + Intronic
1161445187 19:4314547-4314569 GGTTGCGGTGAGCCGAGATCAGG - Intronic
1161995639 19:7709801-7709823 GGCTGCAGTGAGCCGAGATCAGG - Intergenic
1162488743 19:10978559-10978581 GGCCGAGGCAAGCAGAGGTCAGG - Intronic
1162648147 19:12064975-12064997 CCCCGCGGCGACTCGAGGTCTGG + Intronic
1162778702 19:12995784-12995806 GGCCGCGGCGAGGGGAGGCCCGG - Exonic
1162803811 19:13126104-13126126 GGTTGCGGTGAGCCGAGATCGGG - Intronic
1162911580 19:13850634-13850656 CGCCGAGGCCAGCCGAGATCGGG - Intergenic
1163269300 19:16241083-16241105 GGCCGAGGCGGGCAGAGGTCAGG + Intronic
1164630716 19:29759969-29759991 GGCTGCAGCGAGCTGAGATCAGG + Intergenic
1165436542 19:35798320-35798342 GGCCGAGGCGGGCAGAAGTCAGG - Intergenic
1165489027 19:36112777-36112799 GGCCCCTGGGAGCAGAGGTCAGG - Exonic
1166546973 19:43639721-43639743 GGCCGCGGCGGGGCCAGGTAGGG - Exonic
1166704581 19:44901505-44901527 GGCCAAGGCGGGCCGAGGTAAGG + Intronic
1167114388 19:47480270-47480292 GGCCGCGGTGAGGCGGGGTAAGG - Intronic
1167279781 19:48560121-48560143 GTCAGCTGCGAGCCCAGGTCAGG - Intronic
1167683987 19:50944064-50944086 GGCTGCAGTGAGCTGAGGTCAGG - Intronic
1167978787 19:53255043-53255065 GGACGCGCCGAGGAGAGGTCCGG - Intergenic
1168069304 19:53940997-53941019 GGTTGCGGTGAGCCGAGATCGGG + Intronic
1168675845 19:58277620-58277642 GGTTGCCGTGAGCCGAGGTCAGG - Intronic
925511166 2:4626862-4626884 GGCCGAGGCGGGTGGAGGTCAGG - Intergenic
926423244 2:12718428-12718450 GGGCTCGGGGAGCCGAGGTTCGG - Exonic
926576161 2:14584360-14584382 GGCCGAGGCGGGCCTCGGTCAGG + Intergenic
926719986 2:15952650-15952672 GGCTGCAGTGAGCCGAGATCAGG - Intergenic
927215620 2:20666713-20666735 GGCCGCGGCGCGAAGCGGTCTGG + Exonic
927424870 2:22970755-22970777 GGCAGCGGCTACCCGGGGTCGGG - Intergenic
930637711 2:53824019-53824041 GGTTGCGGCAAGCCGAGATCGGG + Intergenic
931253381 2:60551808-60551830 GGCTGGGGCGCGGCGAGGTCGGG + Intronic
932591591 2:73071024-73071046 TGCCGAGGCGAGCGGCGGTCCGG - Intronic
934582495 2:95455623-95455645 GGTTGCGGTGAGCCGAGATCAGG - Intergenic
934596955 2:95621091-95621113 GGTTGCGGTGAGCCGAGATCAGG + Intergenic
935766742 2:106375426-106375448 GGTTGCGGTGAGCCGAGATCGGG - Intergenic
936378258 2:111961388-111961410 GGCTGAGGCGGGCGGAGGTCAGG - Intronic
937047127 2:118857738-118857760 GCCCGCGGAGAGCCCAGGGCGGG + Intergenic
938876258 2:135533808-135533830 GGCAGCGGTGAGCCGAGATCAGG + Intronic
939251668 2:139688702-139688724 GGCAGAGGCGGGCAGAGGTCAGG - Intergenic
942054802 2:172172582-172172604 GGCGGTGGCGGGCCGTGGTCCGG + Intergenic
943645969 2:190408322-190408344 GGGCGCGGCGAGGCGAGGCGAGG - Intergenic
944263591 2:197700380-197700402 GGTTGCGGTGAGCCGAGATCAGG - Intronic
944620218 2:201506614-201506636 GGTTGCAGTGAGCCGAGGTCAGG - Intronic
946427749 2:219608445-219608467 GGCTGGGGCGAGCTGAGGCCAGG + Intronic
947213529 2:227729175-227729197 GGCCGAGGCGGGCGGAGTTCAGG + Intergenic
1172911626 20:38413739-38413761 GGCCGAGGCAGGCTGAGGTCAGG + Intergenic
1173602455 20:44305757-44305779 GGTTGCGGTGAGCCGAGATCGGG + Exonic
1174318293 20:49720102-49720124 GGTTGCGGTGAGCCGAGATCAGG - Intergenic
1174778498 20:53367339-53367361 GGCTGCAGTGAGCCGAGATCAGG + Intronic
1174829252 20:53797709-53797731 GGCCAAGGCAAGCTGAGGTCAGG - Intergenic
1175859483 20:62142852-62142874 CGCCCCGGCGAGCAGAGGCCGGG - Intronic
1176112733 20:63417924-63417946 GGCCGCGCCGAGGCCAGGGCAGG - Intronic
1176795694 21:13369574-13369596 GGTTGCGGTGAGCCAAGGTCAGG + Intergenic
1177431688 21:20998262-20998284 GGGCGCGGCGAGGGGAGGTGCGG - Intergenic
1178334341 21:31731156-31731178 GGCCGCGGCGCGTCGACGGCTGG - Intronic
1178487453 21:33027876-33027898 GGCCGCGGGGAAGCGAGGACTGG + Exonic
1178707639 21:34888810-34888832 GGCGGCGGCGAGCCGCGCCCTGG - Intronic
1178734378 21:35135686-35135708 GGCCGGGGGGAGCTGTGGTCTGG + Intronic
1178831315 21:36059458-36059480 GCCCGAGGCGGGCTGAGGTCAGG + Exonic
1179918966 21:44496824-44496846 GACAGCGGCGAGCCCACGTCTGG + Intergenic
1180190698 21:46161208-46161230 GGCAGCGGCGGGCTGCGGTCGGG + Exonic
1181057653 22:20267727-20267749 GGCCGGGGCGCTCCGAGGCCGGG + Intronic
1183201307 22:36387444-36387466 GGCCTGGGCGAGGCGAGGGCGGG + Intronic
1183398591 22:37587775-37587797 GGCTGCAGTGAGCCGAGATCGGG + Intergenic
1184034049 22:41910242-41910264 GGCCGGGGCGGGCCGGGGGCGGG + Intronic
1184101595 22:42343994-42344016 GGCCGCGGCGCGCCGGGCTGGGG + Intergenic
1184692675 22:46124294-46124316 GGCAGTGGCGAGCCAAGGACGGG - Intergenic
1184726078 22:46347412-46347434 GGCTGCAGCGAGCCAAGATCGGG - Intronic
1184955775 22:47885062-47885084 TGCAGCGGCGAGCCCAGGGCTGG + Intergenic
949304322 3:2622507-2622529 GGCCGAGGTGGGCTGAGGTCAGG - Intronic
949446827 3:4144051-4144073 GGCTGCAGAGAGCCGAGATCGGG - Intronic
953430383 3:42834946-42834968 GGCTGCAGTGAGCCGAGATCGGG - Intronic
954184299 3:48905123-48905145 GGTTGCGGTGAGCCGAGATCTGG - Intergenic
957054185 3:75431673-75431695 GGCTGCGGTGAGCCAAGATCGGG - Intergenic
958066187 3:88546723-88546745 GGTTGCAGTGAGCCGAGGTCAGG - Intergenic
960109981 3:113836704-113836726 GGCTGCAGGGAGCCGAGATCAGG - Intronic
962859830 3:139389453-139389475 GGCCGCGGTAAGCAGTGGTCTGG - Intronic
963786190 3:149536676-149536698 TGCCCCGGCGACCCGAGGCCAGG + Intronic
965261759 3:166495640-166495662 GGCCCAGGTGGGCCGAGGTCAGG - Intergenic
967164290 3:186766855-186766877 GGCTGCAGTGAGCCGAGATCTGG - Intergenic
968099529 3:195955312-195955334 GGTTGCGGTGAGCCGAGATCAGG + Intergenic
968515089 4:1012382-1012404 GGCCGCGGGGATCAGGGGTCTGG - Intronic
968768941 4:2491297-2491319 GGTTGCAGTGAGCCGAGGTCGGG - Intronic
970042739 4:11814456-11814478 GGTTGCAGTGAGCCGAGGTCGGG + Intergenic
973775648 4:54238908-54238930 GGCTGCGGTGAGCTGAGATCAGG + Intronic
973982097 4:56315423-56315445 GGCCCCGGCGACGCGAGGGCGGG + Exonic
976009324 4:80468284-80468306 GGTTGCAGTGAGCCGAGGTCAGG - Intronic
976180239 4:82392033-82392055 GGTTGCAGTGAGCCGAGGTCAGG - Intergenic
976971987 4:91115387-91115409 GGTTGCGGTGAGCCGAGATCAGG - Intronic
978543438 4:109843495-109843517 CACCGCGTCCAGCCGAGGTCAGG + Intronic
982573196 4:157076108-157076130 CGCCGTGGCGCGCCGCGGTCGGG - Exonic
983077520 4:163343984-163344006 GGCCGGGGCGCCCCGAGGTACGG + Intronic
983170235 4:164527874-164527896 GGCTGCAGTGAGCTGAGGTCCGG - Intergenic
983974956 4:173922527-173922549 GGCTAAGGCGGGCCGAGGTCAGG + Intergenic
984146815 4:176071548-176071570 GGCCAAGGTGGGCCGAGGTCAGG - Intronic
984725336 4:183014385-183014407 GGCTGCAGTGAGCCGAGATCAGG + Intergenic
984972306 4:185202483-185202505 GGCTGCAGTGAGCCGAGATCAGG + Intronic
985212635 4:187611748-187611770 GGCCGAGGCAGGCGGAGGTCAGG - Intergenic
985819054 5:2147659-2147681 GGCCAAGGCGGGCCGAGGTCAGG - Intergenic
987683434 5:21166208-21166230 GGTTGCGGTGAGCCGAGGTTGGG + Intergenic
989255854 5:39364961-39364983 GGTTGCGGTGAGCCGAGGTGGGG + Intronic
989360086 5:40592143-40592165 GGTTGCGGTGAGCCGAGATCAGG - Intergenic
991443257 5:66673721-66673743 GGCCGAGGCAGGCAGAGGTCAGG - Intronic
991728856 5:69563008-69563030 GGCTGCAGTGAGCCGAGATCAGG - Intronic
991805285 5:70418157-70418179 GGCTGCAGTGAGCCGAGATCAGG - Intergenic
991866099 5:71064865-71064887 GGCTGCAGTGAGCCGAGATCAGG + Intronic
992940586 5:81757385-81757407 GGCCGGGGCGGGCCAAGGTCTGG + Intergenic
993150431 5:84154760-84154782 GGTTGCGGTGAGCCGAGATCCGG - Intronic
995379714 5:111518404-111518426 GGCTGCAGTGAGCCGAGATCAGG - Intergenic
995507257 5:112873407-112873429 GGTTGCGGTGAGCCGAGATCGGG - Intronic
996810995 5:127516487-127516509 GGCCGAGGCGGGCCGAGGTCAGG + Intergenic
997265000 5:132490356-132490378 GGCCGCGGCGCGGGGAGGGCGGG - Intronic
997916336 5:137929396-137929418 GGTTGCGGTGAGCCGAGATCGGG + Intronic
997965483 5:138352888-138352910 GGCAGCGGCGAGCGGAGATCCGG + Exonic
1001556664 5:172641573-172641595 GCGCGCGCCGAGCTGAGGTCCGG - Intronic
1001734828 5:173989266-173989288 GGCGGCGGCAGGCCGGGGTCGGG + Exonic
1002487679 5:179550733-179550755 GGCCGCGGGCGGCCGAGGGCTGG + Exonic
1002541188 5:179907591-179907613 CGCCGCGACGCGCCGAGGCCGGG + Intronic
1003041127 6:2688119-2688141 GGCTGCAGTGAGCCGAGATCAGG - Intronic
1003282559 6:4706555-4706577 GGCCAAGGCGGGCTGAGGTCAGG + Intronic
1004720118 6:18261506-18261528 GGTTGCGGTTAGCCGAGGTCAGG + Intronic
1004722415 6:18278567-18278589 GGTCGCAGTGAGCCGAGATCGGG - Intergenic
1005578290 6:27210377-27210399 GGTTGCGGTGAGCCGAGATCAGG + Intergenic
1005596350 6:27381969-27381991 GGTTGCAGCGAGCCGAGATCGGG + Intronic
1005957502 6:30674470-30674492 GGTTGCAGTGAGCCGAGGTCAGG + Intergenic
1006956526 6:37878352-37878374 GACAGAGGCAAGCCGAGGTCAGG + Intronic
1007625423 6:43243717-43243739 GGGCGGGGCGGGCCGGGGTCGGG + Intronic
1007701917 6:43770781-43770803 CGCGGCGGCGAGCCGCGGGCAGG + Exonic
1008030314 6:46687819-46687841 GGGCGGGGCCAGCCGAGGCCTGG - Intergenic
1008276685 6:49550945-49550967 GGCAGGGGCGAGCCGAAGCCAGG + Exonic
1008447635 6:51611310-51611332 GGCTGCAGCGAGCTGAGATCAGG + Intergenic
1008956074 6:57217372-57217394 GGTTGCGGTGAGCCGAGATCAGG - Intronic
1011603589 6:89081378-89081400 GGCCGCAGCGGGGCAAGGTCGGG - Exonic
1013373242 6:109488830-109488852 GGTTGCGGTGAGCCGAGATCAGG - Intergenic
1013571351 6:111429729-111429751 GGGCCAGGCGAGCCGAGGGCGGG - Intronic
1015635598 6:135271105-135271127 GGCGGCTGTGAGCCAAGGTCAGG - Intergenic
1016710900 6:147170807-147170829 GGCCGAGGTGGGCAGAGGTCAGG + Intergenic
1017005577 6:150026100-150026122 GGCTGCGGCGAGCCGACATCGGG - Intergenic
1017671952 6:156777655-156777677 CGCCGCGGCGTGGCGAGGCCGGG - Intergenic
1017719952 6:157236832-157236854 CGCCGCCACGTGCCGAGGTCGGG - Intergenic
1017842427 6:158232436-158232458 GGGCGCGGCGGGCGGGGGTCGGG + Intronic
1019171845 6:170137178-170137200 GGCCTCGGCGCGCGGAGGTCGGG - Intergenic
1024465847 7:49711196-49711218 GGCCGCGGCCAGCCCAGGAAGGG - Intergenic
1024641565 7:51333387-51333409 GGTCGCAGTGAGCCGAGATCTGG - Intergenic
1024967216 7:55034294-55034316 GGTTGCAGTGAGCCGAGGTCGGG - Intronic
1026078312 7:67193694-67193716 GGCTGCAGTGAGCCGAGATCAGG + Intronic
1026698506 7:72618277-72618299 GGCTGCAGTGAGCCGAGATCAGG - Intronic
1026843303 7:73683005-73683027 GTACGCGGCGAGCCGGGGTCGGG + Exonic
1027008783 7:74723491-74723513 GGCTGCGGAGAACCGAGATCAGG - Intronic
1027870867 7:83706004-83706026 GGTTGCAGTGAGCCGAGGTCGGG + Intergenic
1028160099 7:87475693-87475715 GGCCGCGGCGAGCAAAGTCCAGG - Exonic
1029290972 7:99502078-99502100 GGTTGCAGTGAGCCGAGGTCAGG - Intronic
1029501923 7:100936613-100936635 GGCCGAGGCGGGCGGAGGTCAGG - Intergenic
1029991872 7:104969886-104969908 GGCTGCAGTGAGCCCAGGTCAGG - Intergenic
1032188466 7:129748210-129748232 GGCTGCAGTGAGCCGAGATCAGG + Intronic
1033654364 7:143362808-143362830 GGCCGCGGCGAGCCGAGCCGGGG - Intergenic
1035167340 7:156999785-156999807 GGCCGGGGCGGGCCGGGGTCAGG - Intronic
1035408865 7:158621569-158621591 GGCTGCAGTGAGCCGAGATCAGG + Intergenic
1038566330 8:28622684-28622706 GGATGCGGTGAGCCGAGGGCGGG + Intronic
1039621035 8:38997136-38997158 GGCCGCGCCGCACCGAGGACTGG - Exonic
1040951422 8:52941317-52941339 GGCCGCGCGGAGCCGACGCCTGG - Intergenic
1042695201 8:71547791-71547813 GGCCGCCGCGAGCCACGGTGGGG + Intronic
1044103529 8:88172052-88172074 GGCCAAGGCGACCTGAGGTCAGG - Intronic
1044698945 8:94949310-94949332 GGGCGCAGCGACCCGAGGGCTGG - Exonic
1045564322 8:103298669-103298691 GGGCTCGGGGTGCCGAGGTCCGG - Intronic
1047717325 8:127607523-127607545 GGCCAAGGCGGGCAGAGGTCAGG - Intergenic
1049396364 8:142402981-142403003 GGCCGCGGCGTGGCGTGGTATGG - Intronic
1049726579 8:144149119-144149141 GGTCCCGGCGAGGCGAGGGCTGG + Intronic
1051917883 9:22229800-22229822 GGCTGCAGTGAGCCGAGTTCAGG - Intergenic
1053919490 9:42973740-42973762 GGCCGAGGCGGGCTGAGGTCAGG + Intergenic
1054569014 9:66789875-66789897 GGCTGCAGCGAGCCAAGATCAGG - Intergenic
1054790663 9:69253678-69253700 GGCCGAGGCGGGCGGAGGTCAGG - Intronic
1055318930 9:75063073-75063095 GGCCGAGGCGGGCGGAGGTCAGG + Intronic
1055833468 9:80410507-80410529 GGCAGCAGCAAGCTGAGGTCTGG + Intergenic
1057832784 9:98419609-98419631 GGCTGCGGAGGGCCCAGGTCAGG + Intronic
1061248425 9:129413388-129413410 GGCCGCGGCGGGCGGGGGCCGGG - Intergenic
1062378765 9:136276773-136276795 GGCAGCGGCGAGGGGAGGCCGGG - Intergenic
1062521301 9:136959073-136959095 GGCGGCGTGGAGCCGAGGCCAGG + Intergenic
1062613359 9:137385027-137385049 GGTCGCAGTGAGCCGAGATCGGG + Intronic
1185659052 X:1712166-1712188 GGCTGCAGCGAGCCGAGATTGGG - Intergenic
1187067514 X:15854888-15854910 GGCTGCGGCGAGCTGAGGGGCGG + Exonic
1187162920 X:16781079-16781101 GGCTGCAGTGAGCCGAGATCGGG - Intergenic
1187535891 X:20141584-20141606 GGCCGAGCAGAGCCGTGGTCCGG + Intronic
1187706539 X:22014892-22014914 GGTTGCGGTGAGCCGAGATCAGG + Intergenic
1190293257 X:49007417-49007439 GGTTGCAGTGAGCCGAGGTCGGG + Intergenic
1190326224 X:49208648-49208670 AGCCCCGGCGAGCTGAGGGCTGG + Exonic
1192503120 X:71665978-71666000 GTCCGCGGGGAGCAGAGGTCAGG + Intergenic
1192510325 X:71717356-71717378 GTCCGCGGGGAGCAGAGGTCAGG + Exonic
1192516372 X:71764197-71764219 GTCCGCGGGGAGCAGAGGTCAGG - Exonic
1192529446 X:71872497-71872519 GTCCGGGGGGAGCAGAGGTCAGG + Intergenic
1199759756 X:150896333-150896355 GGTTGCGGTGAGCCGAGATCAGG + Intronic
1200185223 X:154178267-154178289 GGCCGAGGCGGGCGGAGGTCAGG + Intergenic
1200190876 X:154215405-154215427 GGCCGAGGCGGGCGGAGGTCAGG + Intergenic
1200196627 X:154253207-154253229 GGCCGAGGCGGGCGGAGGTCAGG + Intergenic
1200202282 X:154290325-154290347 GGCCGAGGCGGGCGGAGGTCAGG + Intronic