ID: 900203305

View in Genome Browser
Species Human (GRCh38)
Location 1:1420724-1420746
Sequence TGGGGGTCCCAGCACTGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 342
Summary {0: 1, 1: 1, 2: 5, 3: 39, 4: 296}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900203305_900203321 22 Left 900203305 1:1420724-1420746 CCCACCCAGTGCTGGGACCCCCA 0: 1
1: 1
2: 5
3: 39
4: 296
Right 900203321 1:1420769-1420791 ACCCCTTCACCCCCCAGCGCAGG 0: 1
1: 0
2: 1
3: 18
4: 226
900203305_900203313 -2 Left 900203305 1:1420724-1420746 CCCACCCAGTGCTGGGACCCCCA 0: 1
1: 1
2: 5
3: 39
4: 296
Right 900203313 1:1420745-1420767 CATCCTGCCCCACCCAGAGAAGG 0: 1
1: 0
2: 5
3: 31
4: 303
900203305_900203314 -1 Left 900203305 1:1420724-1420746 CCCACCCAGTGCTGGGACCCCCA 0: 1
1: 1
2: 5
3: 39
4: 296
Right 900203314 1:1420746-1420768 ATCCTGCCCCACCCAGAGAAGGG 0: 1
1: 0
2: 2
3: 25
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900203305 Original CRISPR TGGGGGTCCCAGCACTGGGT GGG (reversed) Intronic
900203286 1:1420670-1420692 CGGGGGTCCCAGCGCTGGGTGGG - Intronic
900203305 1:1420724-1420746 TGGGGGTCCCAGCACTGGGTGGG - Intronic
900460879 1:2801666-2801688 TGGAGGGCCCAGGCCTGGGTGGG + Intronic
901164637 1:7209481-7209503 TGGTGGTTCCAGAACTGGGAGGG + Intronic
901881977 1:12199365-12199387 TGGGGGACCCAGCCCAGGGAGGG + Intronic
902987110 1:20161622-20161644 TGGGGGTGCCAGGATTGGGGTGG - Intronic
903179153 1:21596848-21596870 TGGGGGAGTGAGCACTGGGTTGG - Intronic
903216441 1:21846084-21846106 TGAGGGTCCCTGCAGTGGGACGG - Intronic
904121841 1:28203667-28203689 TGGCGCTCCCAGGACTGAGTGGG - Intronic
904493349 1:30873471-30873493 TGGGAGTCCCAGATCTGAGTTGG + Intronic
905434733 1:37948658-37948680 TGGGGGTCCTCCCACTGGGTGGG + Intergenic
905925239 1:41745052-41745074 TGGGGGTCCCAGCACTATCAAGG + Intronic
906302659 1:44694755-44694777 TTGGGATCCCAGCACTGAGGAGG - Intronic
909240215 1:73203396-73203418 TGGTAATCCCAGCACTTGGTGGG - Intergenic
909853288 1:80496261-80496283 TGGGGACCACAGCACTGGTTTGG + Intergenic
915185022 1:154098254-154098276 TGGGAGTCACAGCCCTGGCTTGG + Intronic
915542858 1:156579775-156579797 TGGGGATCCCCACACTGGATGGG + Intronic
915623219 1:157098739-157098761 TGGGGGCCCCTGCCCTGTGTCGG - Exonic
916787542 1:168097303-168097325 AGGGGCTCCCATGACTGGGTTGG + Intronic
918694841 1:187532762-187532784 TGGAGGTATGAGCACTGGGTTGG - Intergenic
919814273 1:201427972-201427994 TGCAGGTCCCAGCACTGGGCAGG + Intronic
921817965 1:219585857-219585879 TGGGAATCAGAGCACTGGGTGGG + Intergenic
922732527 1:227958606-227958628 CGGGGGTCCCAGCCATGGGGAGG - Intergenic
923443098 1:234039994-234040016 TTTGGGTACCAGCACTTGGTGGG + Intronic
1064227561 10:13500820-13500842 TGGCGGTACCAGCACTGGAAGGG + Intronic
1064397129 10:14991056-14991078 TGGGCGTACCTGCTCTGGGTGGG - Intergenic
1066050840 10:31633394-31633416 TGGGGAACCCTGCTCTGGGTTGG - Intergenic
1066200836 10:33141596-33141618 TGAGGGGCCCAGCACTGGAGGGG + Intergenic
1067285128 10:44902276-44902298 TGGGGGTCCCCAGATTGGGTGGG + Intergenic
1071256187 10:83873867-83873889 AGGGGGTCACAGCACTGGAGAGG - Intergenic
1072443568 10:95478681-95478703 TGGGGGTCCCAGAACTGTGTTGG - Intronic
1073465706 10:103693431-103693453 GCGGGCTCCCAGCGCTGGGTAGG - Intronic
1074490002 10:113931457-113931479 TGGTGCTTCCAGCACTTGGTGGG - Intergenic
1074712958 10:116192746-116192768 TGGGGTTTCCAGCACTGTGGAGG - Intronic
1074824980 10:117208125-117208147 TGAGGGTGACAGCACTGGTTGGG + Intronic
1075298224 10:121296856-121296878 TGGGGGACCCTGCAGTGGCTGGG - Intergenic
1075342135 10:121655614-121655636 TGGCGGTCACAGCACTGGCCTGG - Intergenic
1075517055 10:123117846-123117868 TGGGGGTCCCAGCACCTGGCTGG + Intergenic
1075781481 10:125020273-125020295 TGGTTCTCACAGCACTGGGTGGG + Intronic
1076343693 10:129766570-129766592 TGGGGGTCTCAGCACGGGTTGGG - Intronic
1076514157 10:131033790-131033812 AGGGTGTCCCTGCAGTGGGTGGG + Intergenic
1076542375 10:131222520-131222542 TGGGAGTCCCAGCACCAGGCTGG - Intronic
1076788795 10:132765429-132765451 TGGGGGAGCCAGCACTAGGGAGG + Intronic
1076823220 10:132952363-132952385 AGGGGGTGCCAGCCCTGGGAAGG - Intergenic
1077222626 11:1424321-1424343 GGGGTGCCCCAGCACTGGGTGGG + Intronic
1077401724 11:2361826-2361848 TGGGTGTCCCAGCTCTGGTGGGG - Intergenic
1077912795 11:6587515-6587537 AGGGGGTCACAGCCCTGGCTTGG - Intronic
1078730066 11:13965415-13965437 TGGTGGCCCTAGCACTGGGAAGG + Intronic
1082750356 11:57008210-57008232 TGGGGGTGACAGCAGTGGTTAGG - Intergenic
1082960212 11:58912660-58912682 TGGGAGTCTCACCACTGGGAGGG + Intronic
1083744113 11:64725861-64725883 TGGGGGGCCCAACACAGGGTAGG + Intergenic
1084302623 11:68261404-68261426 TGGGGGTTCCACCTCAGGGTGGG - Exonic
1084553999 11:69865070-69865092 TGGGGGTCAGAGCCCCGGGTTGG + Intergenic
1084638729 11:70411577-70411599 TGGGGCTCCCTGCTGTGGGTTGG + Intronic
1084681571 11:70669463-70669485 TGCACATCCCAGCACTGGGTGGG + Intronic
1084946854 11:72643022-72643044 TGGGGCCCCCAGGCCTGGGTGGG + Intronic
1085048014 11:73364448-73364470 TGGGGGTCCCAGAAATGGCCTGG - Exonic
1085607486 11:77915314-77915336 TGGGGGGCCCATCACTGGAGTGG + Intronic
1085608725 11:77926980-77927002 TGTTACTCCCAGCACTGGGTGGG - Intronic
1085788727 11:79477302-79477324 GGGTGTTCCCAGCACTGGCTTGG + Intergenic
1087266857 11:96070429-96070451 AGGGAGTCCCAGCCCTGGCTTGG - Intronic
1087917961 11:103831877-103831899 TGGTGGTCACAGCACGGGGTTGG - Intergenic
1088893365 11:114060850-114060872 AGGGGGTCACGGCCCTGGGTCGG + Intronic
1089624048 11:119740131-119740153 TGGGTGTGCCAGCTCTGGCTGGG + Intergenic
1090344959 11:126062547-126062569 TGGGGGTCCCGCCGCAGGGTCGG - Intronic
1092263085 12:6962807-6962829 AGGGGATCCCAGCACAGGCTGGG + Intergenic
1093034124 12:14316982-14317004 GGGGTGTCCCAGCCCTGGATTGG + Intergenic
1093519906 12:20036719-20036741 TGTGGGTCCCAGCTCTGTGGTGG + Intergenic
1093892122 12:24534800-24534822 TGGTGCTCCCAGGAGTGGGTGGG + Intergenic
1095826179 12:46531940-46531962 AAGGGGTCACAGCACTGGCTCGG - Intergenic
1096498497 12:52051904-52051926 TGGGGGTCACAGCACCGTGGGGG + Intronic
1096508922 12:52116233-52116255 TGGGTGTACCTGCTCTGGGTGGG - Intergenic
1097037223 12:56131831-56131853 TGAGTGTTCCAGCGCTGGGTTGG + Intronic
1098175693 12:67788287-67788309 TGGGAATTCCTGCACTGGGTGGG + Intergenic
1100261054 12:92932453-92932475 TTGGGGTCACAGCACTGAATGGG - Intergenic
1103390095 12:120566167-120566189 TTGGGGTCCCAACACCGTGTAGG + Intronic
1104356882 12:128094811-128094833 AGGGGATCCCAGCACTGGGTTGG - Intergenic
1105256722 13:18748243-18748265 TGAGGGTGCCAGCAGTTGGTGGG + Intergenic
1106480523 13:30133798-30133820 TGGGGCTCCCAGCTCTGGCCCGG - Intergenic
1106701625 13:32235116-32235138 TGGAGGTCCCTGCTCTGGGTAGG - Intronic
1107841243 13:44459654-44459676 AGGGTGTCACAGCCCTGGGTTGG - Intronic
1108508852 13:51136744-51136766 TGGGGGTCCTGGCCCTGGGCGGG - Intergenic
1108532511 13:51340990-51341012 TGGGGGTCCCAGTCCTCTGTGGG + Intronic
1110940616 13:81343899-81343921 TGGGGCCCCCACCACTGGGTTGG - Intergenic
1111002754 13:82206214-82206236 AGGGTGTCACAGCACTGGCTTGG - Intergenic
1111119318 13:83824547-83824569 TGGGTGTCACAGCACTGGCTTGG - Intergenic
1112003049 13:95229545-95229567 TGGTGGTTCCTGCAGTGGGTTGG - Intronic
1112349715 13:98622799-98622821 TGAGGGTCACAGCCATGGGTAGG - Intergenic
1113550398 13:111188497-111188519 TGGGGGATCCAGCACCGTGTAGG - Intronic
1113744242 13:112731883-112731905 TGGCAGTCCCAGCAGTGTGTGGG + Intronic
1116159675 14:41253107-41253129 AGGGTGTCACAGCCCTGGGTTGG + Intergenic
1117378616 14:55138157-55138179 TGGGGGTGCCTGCCCGGGGTAGG - Exonic
1117842063 14:59870477-59870499 TGGGGAGCCCAGCCCGGGGTTGG - Exonic
1118224749 14:63888305-63888327 TGGGTATCCCAGGCCTGGGTGGG + Intronic
1119180008 14:72599220-72599242 TGGTGGGAACAGCACTGGGTGGG + Intergenic
1119649407 14:76373176-76373198 TGGGGGTACTAGTACTGGGGTGG + Intronic
1119704891 14:76777284-76777306 TGGGGGACCCAGAGCTAGGTGGG - Intronic
1119770898 14:77220114-77220136 TGGGAGTCCCAGCACTGGGCAGG + Intronic
1122206708 14:100151214-100151236 TGGGGGTGCCAGCACTCAGTAGG + Intronic
1122246003 14:100404127-100404149 TATGGGGCCCAGCACTGGGCTGG - Intronic
1122278752 14:100609346-100609368 TGGGGGTCCCAGCCCTGAAGGGG + Intergenic
1122720251 14:103717766-103717788 GGGAGGTCCTAGCATTGGGTGGG + Intronic
1123495109 15:20816515-20816537 TGGGGTCCCCTGCATTGGGTGGG + Intergenic
1123551601 15:21385608-21385630 TGGGGTCCCCTGCATTGGGTGGG + Intergenic
1124408893 15:29418887-29418909 TTGGGGTCCAAGCACATGGTTGG + Intronic
1124595562 15:31088960-31088982 TGGGGCTCCCAGCACTTTCTTGG + Intronic
1125685243 15:41559701-41559723 TGGGGTCCCCAGTACTGGGAAGG - Intronic
1126662745 15:51048476-51048498 TGGGGAGCCCAGCCCTGTGTGGG - Intergenic
1127850150 15:62904992-62905014 AGGGGGGCCCAGCACTGGACTGG - Intergenic
1128264243 15:66253513-66253535 TGGGGGTTCCGGCCCTGGGGAGG - Intronic
1129429013 15:75484807-75484829 TGTGGGTCCTATCACTGGGTGGG + Intronic
1129705256 15:77790674-77790696 CGGGGGGCCCAGCACGTGGTGGG - Intronic
1129738088 15:77976732-77976754 GGTGGGTGGCAGCACTGGGTAGG + Intergenic
1131952044 15:97691848-97691870 TAGGGGTACAAGCACAGGGTGGG - Intergenic
1202959943 15_KI270727v1_random:112850-112872 TGGGGTCCCCTGCATTGGGTGGG + Intergenic
1132519691 16:381568-381590 TGGGGGTCCCCGCCGCGGGTTGG - Intronic
1132629761 16:911562-911584 TGGGGGAGGCAGCACTGGGGGGG + Intronic
1132865880 16:2092508-2092530 TGGGGGCCCCAGCTCTGGGCTGG + Exonic
1134399075 16:13892384-13892406 TGTGGATCCAAGCACTGGGATGG - Intergenic
1134688212 16:16173235-16173257 TGGAGGTGGCAGCAGTGGGTGGG + Intronic
1135993127 16:27229444-27229466 TGTGGGGCCCAGCACTTGGCAGG + Intronic
1136355829 16:29744476-29744498 TGGGGGCCCCAGCCCTGGGAGGG - Exonic
1140003902 16:71055949-71055971 TGGGGACCTCAGCACTGGGCTGG - Intronic
1141464137 16:84195601-84195623 TGGGGGTCCGGGCCCTGGCTGGG - Exonic
1142863582 17:2777507-2777529 TGGGGGTGCCGGCCCTGAGTGGG + Intronic
1143118978 17:4595712-4595734 TGGGGCTCCCAGCTCTGGCCAGG - Intronic
1143118983 17:4595724-4595746 TGGGAGCCCCAGCATGGGGTTGG + Intronic
1145971589 17:28959548-28959570 GGGGGGTCCCAGCAATTTGTGGG - Intronic
1146488153 17:33260711-33260733 ATGGGGCCCCAGCACTGGGTTGG - Intronic
1146662189 17:34672307-34672329 AGAGGGGCCCAGCACTGGGAAGG + Intergenic
1147059350 17:37862180-37862202 TGGGGGGGCCAGCAGGGGGTAGG + Intergenic
1147403398 17:40194194-40194216 TGGGGGTCCCAGCCCTGACCAGG - Exonic
1149970277 17:61211044-61211066 CTAGGGTCCCAGCGCTGGGTGGG + Intronic
1150125452 17:62631951-62631973 TGGGGGTCCCTGGACTTGGAAGG + Intronic
1152000973 17:77645099-77645121 TGGGGGTCCCAGAATGGGGGAGG - Intergenic
1152523188 17:80872458-80872480 CAGCTGTCCCAGCACTGGGTCGG + Intronic
1152703228 17:81829787-81829809 AGGTTGTCCCAGCACTGGGTGGG - Intronic
1153653519 18:7262155-7262177 TGGGTGTCCCAGCTATGGATAGG + Intergenic
1154378301 18:13826991-13827013 TGGGGCCCCCAGAAATGGGTGGG - Intergenic
1154431630 18:14313132-14313154 TGAGGGTGCCAGCAGTTGGTGGG - Intergenic
1154434321 18:14332435-14332457 TGAGGGTGCCAGCAGTTGGTGGG - Intergenic
1155162417 18:23206578-23206600 TGGACATCCCAGCAATGGGTGGG - Intronic
1159849852 18:73514820-73514842 TGGGTGTCACAGCCCTGGCTTGG + Intergenic
1160879392 19:1312725-1312747 TGCCGTTCCCAGCACTGGATGGG + Intergenic
1160974636 19:1786856-1786878 CGGGGGCTCCAGCACAGGGTGGG + Intronic
1161283572 19:3457994-3458016 TGGGTGAGCCAGCACTGGGCTGG - Intronic
1161319447 19:3634208-3634230 GAGGGGTCCCAGGTCTGGGTGGG + Intronic
1161327469 19:3670656-3670678 TGAGGACCCCAGCCCTGGGTGGG + Intronic
1161614088 19:5260512-5260534 TGGGGCTCCCAGCACTCTGGGGG + Intronic
1161966944 19:7554251-7554273 TGGGGGCCTCCGCACTGGATAGG + Exonic
1162312268 19:9914236-9914258 TGGGTGTCCCAACAGTGGGTGGG - Intronic
1162328405 19:10012011-10012033 TGGGGGTCCCAGCACGGTGAGGG - Intergenic
1162385134 19:10356538-10356560 CCAGGGTCCCAGCACTGGGATGG + Intronic
1162459101 19:10803727-10803749 GGGTGGCCCCAGCCCTGGGTGGG + Intronic
1162523410 19:11194687-11194709 AGTGGGTCCCAGACCTGGGTTGG - Intronic
1163126457 19:15246795-15246817 TGGGGGCCCCAGCACTTGCAAGG - Intronic
1163207081 19:15811596-15811618 TGGGGATCCCAGCAGAGGGAGGG - Intergenic
1163705077 19:18807796-18807818 TGGGGTTCCCAGGTCTGGGAGGG - Intergenic
1165313702 19:35042386-35042408 TGGGGGCGCCAGGACTGGGCTGG + Exonic
1165847778 19:38829692-38829714 TGGTGGTCCCAGTACTCGGGAGG + Intronic
1166000994 19:39877329-39877351 GTGGGGTCCCAGGACAGGGTGGG + Intronic
1166003775 19:39893582-39893604 GTGGGGTCCCAGAACAGGGTGGG + Intronic
1167037605 19:47003336-47003358 TGCAGCTCTCAGCACTGGGTGGG + Exonic
1167166963 19:47804917-47804939 TCGGGGCCCCAGCCCTGGGAAGG - Intronic
1167311640 19:48740595-48740617 CACGGCTCCCAGCACTGGGTGGG + Exonic
1167498236 19:49831382-49831404 TGGGAGCCCCAGCCCTCGGTGGG + Exonic
1167613782 19:50519905-50519927 TGGGGGACCAAGCACAGGGGTGG + Intronic
925325076 2:3012442-3012464 TGGTGGTGGCAGCAATGGGTGGG - Intergenic
926282792 2:11464173-11464195 AGGGGTCCCCAGCAGTGGGTTGG + Intronic
927574402 2:24189556-24189578 TGGTGGTCCCAGCACTTAGCTGG + Intronic
934900468 2:98155771-98155793 GGGGGTTCCCAGCACTGTGCAGG + Intronic
935428077 2:102942323-102942345 TGGGTGTCCCAGATCTGAGTTGG + Intergenic
941779483 2:169428468-169428490 TGGAAGTCCCAGCACTAGCTAGG - Intergenic
942138475 2:172953743-172953765 TGGTGGTCCCAGCATTCGGTGGG + Intronic
948455465 2:238102580-238102602 TAGGGGTCCCAGCACAGGGGTGG - Intronic
948487196 2:238288554-238288576 TCGGGGTCCCAGCGCCGGCTCGG - Exonic
948686625 2:239674492-239674514 TGGGGGTCCCATCTCTGGGCTGG + Intergenic
1168880863 20:1204901-1204923 TGGGGTTCCCAGCACGGAGGTGG - Intronic
1170040305 20:12033226-12033248 TGGGAGACACATCACTGGGTTGG + Intergenic
1170566833 20:17612369-17612391 TGGGGGGCCCTGGACTGGGGAGG - Intergenic
1170686969 20:18577995-18578017 TGGAGGTCCCAGGACTCGGTTGG + Intronic
1172135027 20:32681130-32681152 TGGGGGTGGCAGCAGTGGGGAGG - Intergenic
1172448400 20:35004995-35005017 TTGTGGTCTCAGCACTGGGCCGG - Intronic
1174378523 20:50141769-50141791 TGGGCTTCCCAGCAATGGATGGG + Intronic
1176443518 21:6799295-6799317 TGGGGTCCCCTGCATTGGGTGGG - Intergenic
1176821687 21:13664338-13664360 TGGGGTCCCCTGCATTGGGTGGG - Intergenic
1178221441 21:30664939-30664961 TGGTGGTCACAGCACTAGGTGGG - Intergenic
1178487412 21:33027709-33027731 GGGGGCTTCCAGCACTGGGGCGG + Exonic
1179242217 21:39602303-39602325 TGTGGGTGCCAGCAGTGGCTTGG + Intronic
1179436224 21:41363953-41363975 TGGGGGCCCCAGCCCAGGGCTGG - Intronic
1179999615 21:44989378-44989400 CAGGGGTCCCAGCACTGGTCTGG + Intergenic
1180080123 21:45482865-45482887 TGGGGGTCCGAGCACTGAGTGGG - Intronic
1180156337 21:45979237-45979259 GGGCGGTCCCAGGCCTGGGTGGG - Intergenic
1180764170 22:18234084-18234106 AGGGGGTCCCATCCCTGGGAAGG + Intergenic
1180771472 22:18390457-18390479 AGGGGGTCCCATCCCTGGGAAGG - Intergenic
1180802854 22:18640072-18640094 AGGGGGTCCCATCCCTGGGAAGG - Intergenic
1180833082 22:18915949-18915971 AGGGGGTCCCATCCCTGGGAAGG + Intronic
1180939132 22:19645384-19645406 TGGGGGCCCCAGAACTTGTTTGG + Intergenic
1180961155 22:19762978-19763000 TGGGGGCTCCAGCGCTGGGCTGG + Intronic
1180981165 22:19878673-19878695 CGGGGGTCCCAGGCCTGGGTGGG - Intronic
1181066743 22:20310305-20310327 AGGGGGTCCCATCCCTGGGAAGG - Intergenic
1181085916 22:20439273-20439295 GAGGGGCCCCAGCACTGGGAGGG - Intronic
1181218864 22:21355189-21355211 AGGGGGTCCCATCCCTGGGAAGG + Intergenic
1181501044 22:23315693-23315715 TGGGGCTCCCAGACCTGGGCGGG - Exonic
1181521146 22:23449406-23449428 TGGGGGCGCCAGCTCGGGGTGGG - Intergenic
1182064185 22:27418724-27418746 TCTGAATCCCAGCACTGGGTTGG - Intergenic
1182451037 22:30421870-30421892 TGTGTGTCGCAGCACTGGGTTGG - Intronic
1183654631 22:39177418-39177440 TGGAGTTCCCAGGACTGGGCAGG - Intergenic
1184782084 22:46654562-46654584 TGGAGGTCCCTGCAGGGGGTGGG + Intronic
1185323131 22:50211019-50211041 TGGGGGTGCCAGGGCTGGGGTGG - Intronic
1185384974 22:50527402-50527424 TGGGGGTGGCAGCACCTGGTGGG + Intronic
1203233311 22_KI270731v1_random:131448-131470 AGGGGGTCCCATCCCTGGGAAGG - Intergenic
1203283166 22_KI270734v1_random:141253-141275 AGGGGGTCCCATCCCTGGGAAGG + Intergenic
949881358 3:8663546-8663568 TGGGGGCCACAGCAGTGGGGCGG + Intronic
952619629 3:35322171-35322193 TGGGGGCCACAGGACTGGTTGGG + Intergenic
953379292 3:42454917-42454939 TGGGGGTACAGGCACTGGGTAGG + Intergenic
954213059 3:49109091-49109113 TGGGGGCCCCAAGACTGGGTGGG - Exonic
954671586 3:52294009-52294031 TGGGGGTCCCAGCACTGGGATGG + Intergenic
954692216 3:52401684-52401706 TCAGGGACCCAGCACTGGGCTGG - Exonic
955416469 3:58696544-58696566 TGGGGGTCCCTGCAATGGTGAGG - Intergenic
956369043 3:68538089-68538111 TGGGGGCCACAGGACTGGTTGGG + Intronic
956778440 3:72585975-72585997 TGGGGGACACAGCACTAGGGTGG + Intergenic
958441607 3:94162635-94162657 TGCTGGTCCCAGCACTAGGCAGG + Intergenic
960943110 3:122947355-122947377 TGGGATTCCCAGCTGTGGGTTGG - Intronic
961505680 3:127369330-127369352 TGGGCCTCCCAGTACTGGGTAGG - Intergenic
961812426 3:129529550-129529572 TGGGGGCCCAAGCTCAGGGTGGG + Intronic
962105080 3:132381760-132381782 TGGGAGTCACAGCCCTGGCTCGG + Intergenic
966812113 3:183856064-183856086 AGGGGTTCCCAGCCCTGGGCAGG - Intronic
966840235 3:184082059-184082081 AGGGAGTCCCAGCCCTGGCTTGG - Intergenic
966851314 3:184166769-184166791 TGTTGGGCCCAGCAGTGGGTGGG + Intronic
967864518 3:194179378-194179400 TGGGGGAAGCAGCTCTGGGTGGG + Intergenic
968055511 3:195688586-195688608 TGGGGGCCTCAGCACTAGGAAGG + Intergenic
968100282 3:195960011-195960033 TGGGGGCCTCAGCACTAGGAAGG - Intergenic
968512725 4:1002657-1002679 TGGGAGGCCCGGCCCTGGGTCGG + Intronic
968606799 4:1539359-1539381 AGGAGGCCCCGGCACTGGGTGGG + Intergenic
968974151 4:3812299-3812321 AGGGGGTCCCACCTCTGAGTGGG - Intergenic
969429823 4:7147643-7147665 TGGGGGGCCCAGGCCTGGGCAGG - Intergenic
969442192 4:7224049-7224071 TGGGGGTCCCAGGGCTGGTGGGG + Intronic
970704346 4:18782533-18782555 TGGGGGTACAAGGACTGGGAAGG + Intergenic
970768985 4:19587182-19587204 TGCAGTTCCCAGCACTAGGTTGG - Intergenic
977370296 4:96126369-96126391 TGGCGAGCCCAGCACTTGGTGGG - Intergenic
981178219 4:141707733-141707755 TTGGGGTGGGAGCACTGGGTTGG + Intronic
981654367 4:147096357-147096379 TGGGGATCCTTGCACTGGGGAGG - Intergenic
982918826 4:161249287-161249309 AGGGTGTCACAGCCCTGGGTTGG + Intergenic
984622273 4:181967289-181967311 TGGGGGTTACAGAACTGGGTAGG - Intergenic
985492279 5:186901-186923 TGGGGGTCCCAGTACTGAGGTGG - Exonic
985503425 5:263362-263384 TGGGGGCCTCAGCACTAGGAAGG + Intergenic
985569752 5:638567-638589 GGGGGGTCCCAGAGCTGGGTGGG + Intronic
985734268 5:1568923-1568945 TGGGGGCCTCAGCACTAGGAAGG - Intergenic
986070421 5:4277734-4277756 TGACGCTTCCAGCACTGGGTGGG - Intergenic
992663823 5:78986014-78986036 TGGGGGAGCCAGCTCTGAGTGGG - Intronic
992790563 5:80209799-80209821 GGAGGCACCCAGCACTGGGTAGG + Intronic
993477279 5:88380874-88380896 TGGGGGTCCCAGTAATGAATGGG + Intergenic
993942588 5:94078247-94078269 TGAGGTTCCCAGGACTGGTTTGG + Intronic
995332151 5:110957435-110957457 TGGGTGTCACAGCTCTGGCTCGG - Intergenic
995468522 5:112475713-112475735 TGGGGATACCTGTACTGGGTAGG - Intergenic
997518473 5:134506948-134506970 TGGGGCTCCAAGCAGTGGGAGGG + Intergenic
1002052133 5:176577165-176577187 TGTGGGTCCCAGACCTGGGCTGG - Intronic
1002640019 5:180626313-180626335 TGGGGGTGCCAGCATGAGGTTGG - Intronic
1003479643 6:6519275-6519297 TGGGGGACCAGGCATTGGGTAGG - Intergenic
1004517747 6:16335046-16335068 TAGGGGTCCCTGCCCTGGTTGGG + Intronic
1006370941 6:33643246-33643268 TGGGAGTCCCAGCAATGGCCAGG - Intronic
1006396890 6:33793441-33793463 GGGGGAGCCCAGCACTGGCTGGG - Intergenic
1006520561 6:34568735-34568757 TTGGGGTCCGAGCACAGGGCAGG - Intergenic
1006642298 6:35495718-35495740 AGGTGGCCCCAGCACTGGGGTGG + Intronic
1008097240 6:47351469-47351491 TGGGGAACCCAGGACTTGGTGGG - Intergenic
1008496912 6:52143563-52143585 TGAGGCTCACAGCACTGGCTGGG - Intergenic
1008693969 6:54012510-54012532 TGGTGGTCACAGCATTGGGGAGG - Intronic
1014171793 6:118287164-118287186 TGGTCTTCCCAGCACTGGTTAGG - Intronic
1017064779 6:150518725-150518747 TGGAGATCCTAGCCCTGGGTGGG + Intergenic
1017414455 6:154205021-154205043 TGGAGGTCCAAGCAATGGGAAGG - Intronic
1017892359 6:158649414-158649436 TGGTGGCCCCAGTACTGGCTCGG + Intergenic
1018638427 6:165885075-165885097 TGTAGTTCCCAGCTCTGGGTGGG - Intronic
1018676609 6:166227636-166227658 TGGGGATCCTAGCATGGGGTGGG - Intergenic
1019329605 7:455967-455989 TGGGGGTCCCGGCGTTGGGGTGG - Intergenic
1019329646 7:456067-456089 TGGGGGTCCCGGCATTGGGGTGG - Intergenic
1019329663 7:456110-456132 TGGGGGTCCCAGCGTTGGAGTGG - Intergenic
1019329701 7:456210-456232 TGGGGGTCCCGGCGTTGGGGTGG - Intergenic
1019329719 7:456253-456275 TGGGGGTCCCAGCGTTGGAGTGG - Intergenic
1019329772 7:456395-456417 TGGGGGTCCCAGCGTTGGAGTGG - Intergenic
1019329810 7:456495-456517 TGGGGGTCCCGGCATTGGGGTGG - Intergenic
1019329911 7:456751-456773 TGGGGGTCCCAGCGTTGGAGTGG - Intergenic
1019330043 7:457094-457116 TGGGGGTCCCGGCGTTGGGGTGG - Intergenic
1019330063 7:457137-457159 TGGGGGTCCCAGCGTTGGAGTGG - Intergenic
1019330087 7:457195-457217 TGGGGGTCCTGGCATTGGGGTGG - Intergenic
1019330130 7:457295-457317 TGGGGGTCCCGGCGTTGGGGTGG - Intergenic
1019330150 7:457338-457360 TGGGGGTCCCAGCGTTGGAGTGG - Intergenic
1019330173 7:457396-457418 TGGGGGTCCTGGCATTGGGATGG - Intergenic
1019330185 7:457425-457447 TGGGGGTCCCGGCATTGGGGTGG - Intergenic
1019330205 7:457468-457490 TGGGGGTCCCAGCGTTGGAGTGG - Intergenic
1019330228 7:457526-457548 TGGGGGTCCTGGCATTGGGATGG - Intergenic
1019330240 7:457555-457577 TGGGGGTCCCGGCATTGGGGTGG - Intergenic
1019330274 7:457640-457662 CGGGGGTCCCAGCATTGGAGTGG - Intergenic
1019330300 7:457698-457720 TGGGGGTCCCGGCATTGGGGTGG - Intergenic
1019408712 7:897503-897525 TGAGGGGCCCAGCATTGGGGGGG + Intergenic
1019502503 7:1371385-1371407 AGGGGGTCACGGCCCTGGGTCGG + Intergenic
1020579114 7:9971842-9971864 TGGGGGTACAGGCATTGGGTAGG - Intergenic
1023648494 7:42344183-42344205 TTGGGGTCCCAGAACTACGTTGG + Intergenic
1023691612 7:42794929-42794951 TGGGGACCGCAGCACTGGGGAGG + Intergenic
1023821558 7:43983355-43983377 CTGGGGTCCGAGCACTGAGTGGG + Intergenic
1024626239 7:51210424-51210446 TGCGGGTTCCAGCCCTGGGAAGG - Intronic
1029977631 7:104849456-104849478 TGGGTGGCCCTGCACTGTGTGGG + Intronic
1035683106 8:1503293-1503315 TGGGGGTTCCAGGGCTGGGGAGG - Intronic
1036755453 8:11468047-11468069 GGCAGGTCCCAGAACTGGGTAGG - Intronic
1036794344 8:11744416-11744438 CCGGGATGCCAGCACTGGGTGGG + Intronic
1037598637 8:20374804-20374826 TGGAGGTCCCAGCCCTGAGGAGG - Intergenic
1038383662 8:27120637-27120659 TGGGGGTCCCCAGGCTGGGTAGG - Intergenic
1038608930 8:29041389-29041411 TGGAGGCCCCCACACTGGGTTGG + Intronic
1040868894 8:52079650-52079672 TGTGGGTCCCAGCACAGGAGAGG - Intergenic
1040998980 8:53430989-53431011 TGGGGATCCCTCCACTGGCTGGG + Intergenic
1041734270 8:61093410-61093432 TGGGGGTCCAAAAACTGTGTGGG + Intronic
1047020170 8:120767316-120767338 TGGGGACCCCTGCATTGGGTGGG + Intronic
1050313943 9:4381945-4381967 TGGCAGTCCCAGCACAGGCTGGG + Intergenic
1053788805 9:41671355-41671377 TGGAGTTCCCTGCAATGGGTGGG - Intergenic
1054156335 9:61643413-61643435 TGGAGTTCCCTGCAATGGGTGGG + Intergenic
1054177086 9:61882694-61882716 TGGAGTTCCCTGCAATGGGTGGG - Intergenic
1054476107 9:65574423-65574445 TGGAGTTCCCTGCAATGGGTGGG + Intergenic
1054660448 9:67698112-67698134 TGGAGTTCCCTGCAATGGGTGGG + Intergenic
1056735550 9:89206463-89206485 TGGGGGTCACAGGACTAGTTGGG + Intergenic
1057140054 9:92721005-92721027 TGCTGGTCCCAGCGGTGGGTGGG - Intronic
1057566135 9:96167554-96167576 TGGGAGACCCAGCATTGGGCAGG - Intergenic
1059334563 9:113560697-113560719 TGGGGCTCACAGCCCTGGTTTGG - Intronic
1059393590 9:114016816-114016838 TGGGGGACCCGGGACAGGGTGGG + Intronic
1060135597 9:121150372-121150394 TGGGGGCCCCAGCAGGAGGTGGG - Exonic
1060151961 9:121294514-121294536 CCTGGGTCCCAGCACTAGGTGGG + Intronic
1060243084 9:121921579-121921601 AGGGGGACTCAGCACTGGGGAGG - Intronic
1060557097 9:124513608-124513630 TGGGGGTGGCAGCAATGGGGAGG + Intergenic
1061267424 9:129514897-129514919 AGGGGGTCACAGCCCTGGCTTGG - Intergenic
1061789672 9:133052369-133052391 TGGGGGTGCCAGGACGGGGGAGG - Intronic
1062076557 9:134593027-134593049 TGGGGGACTCAGCACTGGGAGGG + Intergenic
1062357186 9:136170543-136170565 TGGGGGTTCCCGATCTGGGTTGG - Intergenic
1203525682 Un_GL000213v1:85232-85254 TGGGGTCCCCTGCATTGGGTGGG + Intergenic
1185736883 X:2501587-2501609 TGGGGGTCCCAGCAGGGGTCTGG - Intronic
1186643597 X:11482852-11482874 TGGGGAACACAGCACTGAGTGGG + Intronic
1188526989 X:31097600-31097622 TTTGGGTACCAGCACTTGGTGGG + Intergenic
1188904352 X:35774318-35774340 TTTGGGTCCCAGCAAGGGGTTGG + Intergenic
1192219671 X:69188913-69188935 TGGTTGTCCCAGCACAGGATGGG + Intergenic
1194941854 X:100019839-100019861 TGTGCCTCCCAGCACTGGGTTGG - Intergenic
1197654931 X:129106593-129106615 TGGGGCACCCAGCACAGGGTTGG + Intergenic
1199477582 X:148262782-148262804 TGGAAGGCACAGCACTGGGTTGG + Intergenic
1200078786 X:153565418-153565440 TGGGGCTCCCTTCACTTGGTGGG + Intronic
1200118994 X:153781632-153781654 TCCGGGGCCCAGCACTGGCTGGG + Intronic