ID: 900206014

View in Genome Browser
Species Human (GRCh38)
Location 1:1432204-1432226
Sequence CCTTCCCTGAAAGGGAGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900206014_900206021 4 Left 900206014 1:1432204-1432226 CCTCCTCTCCCTTTCAGGGAAGG No data
Right 900206021 1:1432231-1432253 CCCAGCAGAGAGGCAAAGTGAGG No data
900206014_900206023 5 Left 900206014 1:1432204-1432226 CCTCCTCTCCCTTTCAGGGAAGG No data
Right 900206023 1:1432232-1432254 CCAGCAGAGAGGCAAAGTGAGGG No data
900206014_900206027 23 Left 900206014 1:1432204-1432226 CCTCCTCTCCCTTTCAGGGAAGG No data
Right 900206027 1:1432250-1432272 GAGGGGACCCACACAAGGAAGGG No data
900206014_900206024 6 Left 900206014 1:1432204-1432226 CCTCCTCTCCCTTTCAGGGAAGG No data
Right 900206024 1:1432233-1432255 CAGCAGAGAGGCAAAGTGAGGGG No data
900206014_900206025 18 Left 900206014 1:1432204-1432226 CCTCCTCTCCCTTTCAGGGAAGG No data
Right 900206025 1:1432245-1432267 AAAGTGAGGGGACCCACACAAGG No data
900206014_900206028 24 Left 900206014 1:1432204-1432226 CCTCCTCTCCCTTTCAGGGAAGG No data
Right 900206028 1:1432251-1432273 AGGGGACCCACACAAGGAAGGGG No data
900206014_900206019 -6 Left 900206014 1:1432204-1432226 CCTCCTCTCCCTTTCAGGGAAGG No data
Right 900206019 1:1432221-1432243 GGAAGGATGTCCCAGCAGAGAGG No data
900206014_900206026 22 Left 900206014 1:1432204-1432226 CCTCCTCTCCCTTTCAGGGAAGG No data
Right 900206026 1:1432249-1432271 TGAGGGGACCCACACAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900206014 Original CRISPR CCTTCCCTGAAAGGGAGAGG AGG (reversed) Intergenic
No off target data available for this crispr