ID: 900206017

View in Genome Browser
Species Human (GRCh38)
Location 1:1432212-1432234
Sequence TGGGACATCCTTCCCTGAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900206017_900206027 15 Left 900206017 1:1432212-1432234 CCCTTTCAGGGAAGGATGTCCCA No data
Right 900206027 1:1432250-1432272 GAGGGGACCCACACAAGGAAGGG No data
900206017_900206024 -2 Left 900206017 1:1432212-1432234 CCCTTTCAGGGAAGGATGTCCCA No data
Right 900206024 1:1432233-1432255 CAGCAGAGAGGCAAAGTGAGGGG No data
900206017_900206023 -3 Left 900206017 1:1432212-1432234 CCCTTTCAGGGAAGGATGTCCCA No data
Right 900206023 1:1432232-1432254 CCAGCAGAGAGGCAAAGTGAGGG No data
900206017_900206025 10 Left 900206017 1:1432212-1432234 CCCTTTCAGGGAAGGATGTCCCA No data
Right 900206025 1:1432245-1432267 AAAGTGAGGGGACCCACACAAGG No data
900206017_900206031 29 Left 900206017 1:1432212-1432234 CCCTTTCAGGGAAGGATGTCCCA No data
Right 900206031 1:1432264-1432286 AAGGAAGGGGCCCTGCTATTAGG No data
900206017_900206028 16 Left 900206017 1:1432212-1432234 CCCTTTCAGGGAAGGATGTCCCA No data
Right 900206028 1:1432251-1432273 AGGGGACCCACACAAGGAAGGGG No data
900206017_900206026 14 Left 900206017 1:1432212-1432234 CCCTTTCAGGGAAGGATGTCCCA No data
Right 900206026 1:1432249-1432271 TGAGGGGACCCACACAAGGAAGG No data
900206017_900206021 -4 Left 900206017 1:1432212-1432234 CCCTTTCAGGGAAGGATGTCCCA No data
Right 900206021 1:1432231-1432253 CCCAGCAGAGAGGCAAAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900206017 Original CRISPR TGGGACATCCTTCCCTGAAA GGG (reversed) Intergenic
No off target data available for this crispr