ID: 900206018

View in Genome Browser
Species Human (GRCh38)
Location 1:1432213-1432235
Sequence CTGGGACATCCTTCCCTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900206018_900206024 -3 Left 900206018 1:1432213-1432235 CCTTTCAGGGAAGGATGTCCCAG No data
Right 900206024 1:1432233-1432255 CAGCAGAGAGGCAAAGTGAGGGG No data
900206018_900206028 15 Left 900206018 1:1432213-1432235 CCTTTCAGGGAAGGATGTCCCAG No data
Right 900206028 1:1432251-1432273 AGGGGACCCACACAAGGAAGGGG No data
900206018_900206021 -5 Left 900206018 1:1432213-1432235 CCTTTCAGGGAAGGATGTCCCAG No data
Right 900206021 1:1432231-1432253 CCCAGCAGAGAGGCAAAGTGAGG No data
900206018_900206023 -4 Left 900206018 1:1432213-1432235 CCTTTCAGGGAAGGATGTCCCAG No data
Right 900206023 1:1432232-1432254 CCAGCAGAGAGGCAAAGTGAGGG No data
900206018_900206027 14 Left 900206018 1:1432213-1432235 CCTTTCAGGGAAGGATGTCCCAG No data
Right 900206027 1:1432250-1432272 GAGGGGACCCACACAAGGAAGGG No data
900206018_900206026 13 Left 900206018 1:1432213-1432235 CCTTTCAGGGAAGGATGTCCCAG No data
Right 900206026 1:1432249-1432271 TGAGGGGACCCACACAAGGAAGG No data
900206018_900206031 28 Left 900206018 1:1432213-1432235 CCTTTCAGGGAAGGATGTCCCAG No data
Right 900206031 1:1432264-1432286 AAGGAAGGGGCCCTGCTATTAGG No data
900206018_900206025 9 Left 900206018 1:1432213-1432235 CCTTTCAGGGAAGGATGTCCCAG No data
Right 900206025 1:1432245-1432267 AAAGTGAGGGGACCCACACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900206018 Original CRISPR CTGGGACATCCTTCCCTGAA AGG (reversed) Intergenic
No off target data available for this crispr