ID: 900206022

View in Genome Browser
Species Human (GRCh38)
Location 1:1432232-1432254
Sequence CCCTCACTTTGCCTCTCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900206022_900206031 9 Left 900206022 1:1432232-1432254 CCAGCAGAGAGGCAAAGTGAGGG No data
Right 900206031 1:1432264-1432286 AAGGAAGGGGCCCTGCTATTAGG No data
900206022_900206026 -6 Left 900206022 1:1432232-1432254 CCAGCAGAGAGGCAAAGTGAGGG No data
Right 900206026 1:1432249-1432271 TGAGGGGACCCACACAAGGAAGG No data
900206022_900206032 18 Left 900206022 1:1432232-1432254 CCAGCAGAGAGGCAAAGTGAGGG No data
Right 900206032 1:1432273-1432295 GCCCTGCTATTAGGAAACCCTGG No data
900206022_900206025 -10 Left 900206022 1:1432232-1432254 CCAGCAGAGAGGCAAAGTGAGGG No data
Right 900206025 1:1432245-1432267 AAAGTGAGGGGACCCACACAAGG No data
900206022_900206036 28 Left 900206022 1:1432232-1432254 CCAGCAGAGAGGCAAAGTGAGGG No data
Right 900206036 1:1432283-1432305 TAGGAAACCCTGGGTCATTCAGG No data
900206022_900206027 -5 Left 900206022 1:1432232-1432254 CCAGCAGAGAGGCAAAGTGAGGG No data
Right 900206027 1:1432250-1432272 GAGGGGACCCACACAAGGAAGGG No data
900206022_900206028 -4 Left 900206022 1:1432232-1432254 CCAGCAGAGAGGCAAAGTGAGGG No data
Right 900206028 1:1432251-1432273 AGGGGACCCACACAAGGAAGGGG No data
900206022_900206034 19 Left 900206022 1:1432232-1432254 CCAGCAGAGAGGCAAAGTGAGGG No data
Right 900206034 1:1432274-1432296 CCCTGCTATTAGGAAACCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900206022 Original CRISPR CCCTCACTTTGCCTCTCTGC TGG (reversed) Intergenic
No off target data available for this crispr