ID: 900206025

View in Genome Browser
Species Human (GRCh38)
Location 1:1432245-1432267
Sequence AAAGTGAGGGGACCCACACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900206016_900206025 15 Left 900206016 1:1432207-1432229 CCTCTCCCTTTCAGGGAAGGATG No data
Right 900206025 1:1432245-1432267 AAAGTGAGGGGACCCACACAAGG No data
900206022_900206025 -10 Left 900206022 1:1432232-1432254 CCAGCAGAGAGGCAAAGTGAGGG No data
Right 900206025 1:1432245-1432267 AAAGTGAGGGGACCCACACAAGG No data
900206017_900206025 10 Left 900206017 1:1432212-1432234 CCCTTTCAGGGAAGGATGTCCCA No data
Right 900206025 1:1432245-1432267 AAAGTGAGGGGACCCACACAAGG No data
900206018_900206025 9 Left 900206018 1:1432213-1432235 CCTTTCAGGGAAGGATGTCCCAG No data
Right 900206025 1:1432245-1432267 AAAGTGAGGGGACCCACACAAGG No data
900206020_900206025 -9 Left 900206020 1:1432231-1432253 CCCAGCAGAGAGGCAAAGTGAGG No data
Right 900206025 1:1432245-1432267 AAAGTGAGGGGACCCACACAAGG No data
900206014_900206025 18 Left 900206014 1:1432204-1432226 CCTCCTCTCCCTTTCAGGGAAGG No data
Right 900206025 1:1432245-1432267 AAAGTGAGGGGACCCACACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900206025 Original CRISPR AAAGTGAGGGGACCCACACA AGG Intergenic
No off target data available for this crispr