ID: 900206300

View in Genome Browser
Species Human (GRCh38)
Location 1:1433307-1433329
Sequence TCCCAAAGGCGGGTGGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 309}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900206286_900206300 22 Left 900206286 1:1433262-1433284 CCTTCATCTTCTGCAGAAGCCTG 0: 1
1: 0
2: 0
3: 27
4: 291
Right 900206300 1:1433307-1433329 TCCCAAAGGCGGGTGGGGGCAGG 0: 1
1: 0
2: 1
3: 21
4: 309
900206292_900206300 3 Left 900206292 1:1433281-1433303 CCTGGATTGTGCGGAGGAGGGAG 0: 1
1: 0
2: 2
3: 19
4: 223
Right 900206300 1:1433307-1433329 TCCCAAAGGCGGGTGGGGGCAGG 0: 1
1: 0
2: 1
3: 21
4: 309
900206285_900206300 23 Left 900206285 1:1433261-1433283 CCCTTCATCTTCTGCAGAAGCCT 0: 1
1: 0
2: 4
3: 32
4: 327
Right 900206300 1:1433307-1433329 TCCCAAAGGCGGGTGGGGGCAGG 0: 1
1: 0
2: 1
3: 21
4: 309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900206300 Original CRISPR TCCCAAAGGCGGGTGGGGGC AGG Intergenic
900188059 1:1342220-1342242 TCCCACAGGCGAGGGGAGGCTGG - Intronic
900206300 1:1433307-1433329 TCCCAAAGGCGGGTGGGGGCAGG + Intergenic
900600618 1:3501282-3501304 TCCCGAGGGCCGCTGGGGGCTGG - Exonic
900902736 1:5527824-5527846 CCACACAGGCAGGTGGGGGCAGG + Intergenic
902234971 1:15051335-15051357 GCCAAAAGGCAGGTGAGGGCAGG + Intronic
902600952 1:17539889-17539911 TCACAAAGGCGCCTGGCGGCCGG - Exonic
903299445 1:22368154-22368176 TCCCACAGGTGGCAGGGGGCAGG - Intergenic
903499829 1:23794851-23794873 TCCCACAGGCCTCTGGGGGCAGG + Exonic
904939994 1:34158997-34159019 TCCCAAGGGCAGCTGGGGGCTGG - Intronic
905213540 1:36390945-36390967 TCCCACAGGCTGGTGGGCACTGG + Intergenic
905442807 1:38005611-38005633 GCCGAAAGGGAGGTGGGGGCGGG - Intergenic
905802037 1:40850547-40850569 TCCCAAAGGAGGGCGTGGTCAGG - Intergenic
905885247 1:41488294-41488316 TCCCAAAACCCGGTGGGGCCAGG - Intergenic
909682162 1:78303857-78303879 TGCCAAAGACTGGTGGTGGCTGG - Intergenic
910258738 1:85276257-85276279 TGCCCAGGGCGGGCGGGGGCGGG - Intronic
910449427 1:87331067-87331089 TCCAAAGGGCGGGGGGGGGGGGG - Intronic
912740638 1:112192035-112192057 AACCAAAGGAGGGTGGGGGTGGG + Intergenic
912776025 1:112507035-112507057 ACCCAAAGGCAGGAGTGGGCTGG - Intronic
913329458 1:117655083-117655105 GCCCAGAGGCGGGAGGGGGCAGG - Intergenic
915335122 1:155136411-155136433 TACCAGAGGGAGGTGGGGGCGGG + Intronic
915458937 1:156058196-156058218 TCCCAAGAGCAGGTGGGGGTTGG + Intronic
915601141 1:156924042-156924064 GACGAAGGGCGGGTGGGGGCGGG - Exonic
916069122 1:161159759-161159781 CCACAAAGGCGCGTGGGGCCCGG + Intronic
916090595 1:161305565-161305587 TCTCAAAGGGAGGTGAGGGCAGG + Exonic
917739848 1:177951855-177951877 TCCCAAGGGCTTGAGGGGGCGGG - Intronic
918071608 1:181137432-181137454 TCCCATAGGCGGGTGGGGTGTGG - Intergenic
919920979 1:202166271-202166293 GCCCAAAGCCAGGTGGGGGTTGG + Intergenic
920284590 1:204870540-204870562 TCCCCAAGGCGGGGGTGGGGTGG - Intronic
920333446 1:205228389-205228411 TCTTAAAGGCGGGTGAGGGAGGG - Exonic
921055970 1:211542718-211542740 GCCCCATGGTGGGTGGGGGCGGG + Intergenic
922718355 1:227888199-227888221 TCCCCAAGGCGGTGGGGGCCAGG + Intergenic
924017746 1:239745644-239745666 TTCTAAAGGGTGGTGGGGGCGGG - Intronic
1065023986 10:21524582-21524604 TCACTAAGGCGGGGGGGGGGGGG + Intronic
1065571203 10:27072467-27072489 GGGCAAAGCCGGGTGGGGGCTGG - Intronic
1066296358 10:34057216-34057238 TAGCACAGGCGGGTGGGGACAGG - Intergenic
1068788502 10:61001856-61001878 TCCCAGAGGTGGGTGGGTCCTGG - Intergenic
1071291834 10:84194492-84194514 TCCCAGCCGCGGGCGGGGGCAGG - Intergenic
1074302509 10:112245345-112245367 TCAGGAAGGCGGGTGGGGGAAGG + Intergenic
1074543580 10:114385646-114385668 TCACAATGGGGTGTGGGGGCAGG - Intronic
1074553051 10:114463070-114463092 TCGGAAAGGGGGGTTGGGGCGGG + Intronic
1074755857 10:116623738-116623760 TGGGAAGGGCGGGTGGGGGCAGG - Intronic
1075258179 10:120941712-120941734 TCCCATAGGCAGGAGGGCGCAGG - Intergenic
1075399205 10:122149496-122149518 TGCCCAGGGCGGGTGGGGCCGGG - Intronic
1076258067 10:129044649-129044671 TCCCAGAAGCAGGTGGGGACCGG + Intergenic
1076342849 10:129761428-129761450 CACCAAAGGCTGGTGGGGGAGGG - Intronic
1077028513 11:452428-452450 GCCCAAAGGTAGGAGGGGGCCGG + Intronic
1077321899 11:1946536-1946558 TGCCAGAGGCTGGAGGGGGCTGG + Intergenic
1077510698 11:2960302-2960324 TCCCCCAGCAGGGTGGGGGCTGG - Intronic
1078664558 11:13313890-13313912 ACCCAAAGTGGGGTGGGGGTGGG - Intronic
1079373607 11:19872711-19872733 TCCAGCAGGCGGGTCGGGGCAGG - Intronic
1081011045 11:37812540-37812562 GCCCAAAGTCCGGAGGGGGCTGG + Intergenic
1081647295 11:44798977-44798999 TCACAAAGGCGGGGTGGGGGTGG - Intronic
1082784884 11:57311370-57311392 GCCCCAAGGCGGGTTGGGGGCGG - Intronic
1083050547 11:59772418-59772440 CCCCAGAGGTGGCTGGGGGCCGG + Intronic
1083266017 11:61547090-61547112 GTCCAGAGGTGGGTGGGGGCAGG + Intronic
1083594111 11:63910890-63910912 TCCCAAAGGGGGTAGGGGCCCGG + Exonic
1083659449 11:64245464-64245486 GCCCAAAGCGGGGTGGGGGGGGG + Intronic
1083670509 11:64297378-64297400 TCCCACAGGCTCCTGGGGGCGGG + Intronic
1083725685 11:64626895-64626917 TCCCAAAGTGGGGGGCGGGCAGG + Intronic
1083997362 11:66278916-66278938 CCACAAAGGCGGGGGGGGGGGGG - Intronic
1084014761 11:66371828-66371850 TCCCTGAGGCGGGTGGGGGAAGG - Intronic
1084285614 11:68128659-68128681 TCCCAAGGGGGGGCGGGGGTGGG - Intergenic
1088355917 11:108943781-108943803 TCCCGAGGGAGGGAGGGGGCTGG - Intergenic
1090372889 11:126268999-126269021 AGCCAATGGCGGGTGGGAGCGGG + Intronic
1202804915 11_KI270721v1_random:1849-1871 TGCCAGAGGCTGGAGGGGGCTGG + Intergenic
1091440529 12:509198-509220 TCTCAAAGGGGGCTGGGGGTGGG - Intronic
1091973929 12:4810124-4810146 TCCCGGAGGCCGGCGGGGGCGGG + Exonic
1092106233 12:5923483-5923505 TCCCCGAGGGAGGTGGGGGCTGG - Intronic
1092254290 12:6917741-6917763 TCCCAGGGGCGGGTGGGGGAGGG + Intronic
1092405261 12:8217343-8217365 TCATGAAGGTGGGTGGGGGCTGG + Intergenic
1095572254 12:43696673-43696695 TGCAAAAGGAGGGTGGGAGCGGG - Intergenic
1096469318 12:51866130-51866152 TCCCAAGGGTGGGTGCTGGCAGG - Intergenic
1096514008 12:52146575-52146597 ACCCAAAGGGTGGTGGGGTCTGG - Intergenic
1096804287 12:54130912-54130934 TCCCAAAAGTGGGATGGGGCAGG + Intergenic
1097030914 12:56088649-56088671 TCCCAAAGGTGGGTAGGAGATGG + Exonic
1097186449 12:57198917-57198939 GCCCCAAGGAGGGTGGGGGTGGG + Intronic
1098866749 12:75772185-75772207 TCTCACAGGTGGGTGGGGGTTGG + Intergenic
1100382600 12:94075432-94075454 TCCGAAGGCTGGGTGGGGGCGGG + Intergenic
1103126529 12:118427557-118427579 TCCCAAAGAGAGGTGGGAGCAGG - Intergenic
1104692639 12:130838792-130838814 TCCTCAGGGCGGGTTGGGGCAGG - Intronic
1105896018 13:24718082-24718104 TCCAAAAGGGGGGTGGAGGGAGG + Intergenic
1106483883 13:30156149-30156171 TCCCAGAGTGGGGTTGGGGCAGG - Intergenic
1107534268 13:41312118-41312140 TCCCAAAGGGAGGTGGTGCCAGG - Intronic
1112320888 13:98406629-98406651 GCCCACAGGCTGCTGGGGGCAGG - Intronic
1113491922 13:110699031-110699053 ACCCAAGGAGGGGTGGGGGCAGG + Intronic
1113949725 13:114065337-114065359 TCCCAAACGCTGGGGGGAGCCGG + Intronic
1115342948 14:32311620-32311642 TCCCAAAGGCAAGTAGTGGCAGG - Intergenic
1115356750 14:32455822-32455844 TTCCAAAGTAGGTTGGGGGCAGG - Intronic
1117010825 14:51468650-51468672 TCCCAAACCCGGGGGTGGGCAGG + Intergenic
1118721064 14:68594131-68594153 TCTCAAAGGCGTGTGGGGGTGGG - Intronic
1118820401 14:69341790-69341812 TCCCCCAGGCGGGTAGGGGGTGG + Intronic
1119455062 14:74748117-74748139 TCCCAATGGCAGGTGGGGCGTGG + Intergenic
1121052922 14:90831120-90831142 TCCAGAAGGCGGGCAGGGGCTGG + Intergenic
1121110073 14:91306739-91306761 TTACAAAAGCAGGTGGGGGCTGG + Intronic
1121184356 14:91953661-91953683 TCCAACAGGCTGGTGAGGGCTGG - Intergenic
1121621042 14:95348490-95348512 TCCCCAAGGAGCGTGGAGGCAGG + Intergenic
1122822963 14:104356279-104356301 GCCCAGGGGCGGGTGGGGACAGG - Intergenic
1122876148 14:104666298-104666320 TCACCTCGGCGGGTGGGGGCTGG - Intergenic
1122981229 14:105193179-105193201 TCCACAAGGCGGGTGCCGGCAGG - Intergenic
1123049528 14:105534141-105534163 TCCCACAGGCACGTGGAGGCAGG - Intergenic
1123457906 15:20442761-20442783 TCCCAAATCCAGGTGCGGGCAGG - Intergenic
1123660163 15:22557648-22557670 TCCCAAATCCAGGTGCGGGCAGG + Intergenic
1124264054 15:28217914-28217936 TCCCAAATCCAGGTGCGGGCAGG - Intronic
1124314022 15:28652143-28652165 TCCCAAATCCAGGTGCGGGCAGG + Intergenic
1124342850 15:28901291-28901313 CCCCAGAGCTGGGTGGGGGCTGG - Intronic
1124602696 15:31148345-31148367 CTCCAAAGGGGGTTGGGGGCTGG + Intronic
1124624678 15:31301106-31301128 TCCCAGAGCTGGGTGGGGGTGGG + Intergenic
1125028436 15:35053296-35053318 TCGCAAAAGCGGCTGGAGGCAGG - Intergenic
1129393895 15:75234091-75234113 TCCCAAACGAGGGAGGTGGCAGG - Intergenic
1129582912 15:76831382-76831404 TCCTATGGGAGGGTGGGGGCTGG - Intronic
1130417837 15:83710742-83710764 TCCCAAAGGAGGCAGAGGGCTGG + Intronic
1131657825 15:94479825-94479847 TCAGAAAGGCAGGTGGGGGTAGG + Exonic
1131848297 15:96511280-96511302 CCCCAAAGAAGGGTGGGGGTGGG - Intergenic
1132999235 16:2840853-2840875 TCCCAATGGCGAGGGGGGTCTGG + Intergenic
1133115317 16:3575247-3575269 CCCCAAAGGCTGATGGGGGCTGG + Intronic
1133337752 16:5017170-5017192 TTCCAGAGGCGGGTGGGGGGAGG + Exonic
1133794297 16:9033699-9033721 TCCCAAATGTGGGTGGAGGAGGG + Intergenic
1134077775 16:11304150-11304172 TCAGAAAGGTGGGTCGGGGCAGG - Intronic
1134517054 16:14895697-14895719 TCCCACGGGCGGGTAGTGGCCGG - Exonic
1134704724 16:16294351-16294373 TCCCACGGGCGGGTAGTGGCCGG - Exonic
1134766064 16:16759105-16759127 TCCCAAAGGCTAGCTGGGGCTGG - Intergenic
1134962818 16:18417763-18417785 TCCCACGGGCGGGTAGTGGCCGG + Intronic
1134967113 16:18500362-18500384 TCCCACGGGCGGGTAGTGGCCGG + Intronic
1134979982 16:18600109-18600131 TCCCAAAGGCTAGCTGGGGCTGG + Intergenic
1136347183 16:29683693-29683715 TCACAGAGCAGGGTGGGGGCTGG + Intronic
1136702386 16:32156162-32156184 TCCCAAATCCAGGTGCGGGCAGG - Intergenic
1136765281 16:32771326-32771348 TCCCAAATCCAGGTGCGGGCAGG + Intergenic
1136802818 16:33099058-33099080 TCCCAAATCCAGGTGCGGGCAGG - Intergenic
1139472070 16:67183750-67183772 GCCCAATGGAGGGTGGGGCCAGG + Exonic
1140238806 16:73182880-73182902 TGCAAAAGGCGGGAGGGGGGAGG + Intergenic
1140406395 16:74714119-74714141 TCTGAATGGCGGGTGGGGGTCGG + Exonic
1141163041 16:81641767-81641789 TCCCAAAGGCAGTTGCAGGCTGG - Intronic
1141267485 16:82509934-82509956 TCCCAAAGATGGGTGGGTGGTGG + Intergenic
1141802446 16:86320034-86320056 TGCCGAAGGTGGGAGGGGGCGGG - Intergenic
1141844623 16:86598974-86598996 TCTCAAAAGCAGGTGGAGGCAGG - Intergenic
1142182467 16:88677959-88677981 AACCAAAGGCTGGCGGGGGCTGG + Exonic
1203067669 16_KI270728v1_random:1033559-1033581 TCCCAAATCCAGGTGCGGGCAGG + Intergenic
1142708427 17:1710350-1710372 TCCCAAAGGCGCGGCGGGGAGGG - Exonic
1143107901 17:4538542-4538564 CCCCCAAAGCGGGTTGGGGCTGG - Exonic
1143372982 17:6451877-6451899 TCCCATCGGCGGGCGGGGGGGGG - Exonic
1143583457 17:7839432-7839454 TCCCCCAGGCGGGTGCAGGCAGG - Intergenic
1144782498 17:17815061-17815083 TCCCACAGGCTGGTGGGGAGAGG + Intronic
1144945718 17:18968562-18968584 ACCCACTGGGGGGTGGGGGCAGG + Intronic
1145885732 17:28381327-28381349 TGCCAGAGGCTGGTGGCGGCCGG + Exonic
1147931230 17:43982933-43982955 TGCCAAAGGCAGCTGGAGGCCGG + Intronic
1148356850 17:46980998-46981020 TAGCGAAGGGGGGTGGGGGCAGG + Intronic
1148460689 17:47837618-47837640 GCCCAAAGGCAGCTGTGGGCTGG - Exonic
1148550992 17:48550744-48550766 TACCGAAGGCGGGTGGGGACGGG + Exonic
1149296240 17:55264915-55264937 GCCCATAGGCGTGCGGGGGCGGG - Intergenic
1149705624 17:58692059-58692081 TCCCAGCGGCCGTTGGGGGCTGG + Intergenic
1151578353 17:74963901-74963923 TCTCAACGGCCTGTGGGGGCAGG + Exonic
1152035324 17:77868623-77868645 TCCCCAAGCCGGCTGGGGTCAGG - Intergenic
1152073105 17:78143848-78143870 TCCCCAAGGCTGGGGGTGGCTGG - Intergenic
1152237447 17:79145900-79145922 TTCCAAAGGCCGCCGGGGGCAGG + Intronic
1152239725 17:79155019-79155041 TCCAAAGGGTGGGTGGGGGAGGG + Intronic
1152577518 17:81149379-81149401 TCCCACAGGCCGGGGAGGGCAGG - Intronic
1152612415 17:81322368-81322390 TCCAGAAGGCGGGTGGGCACCGG - Intronic
1152781656 17:82229594-82229616 GCCCAAGGGCGGGTGTGGGTCGG - Intronic
1157181981 18:45506205-45506227 TCTCAAAGGCTAGTGGGAGCAGG - Intronic
1157496170 18:48158949-48158971 CCCCAGAGGAGGGTAGGGGCTGG + Intronic
1157580600 18:48771809-48771831 TCCCCGCGGCGGCTGGGGGCCGG - Intronic
1157867360 18:51197767-51197789 GCCCGAAGGAGGGTGGGGGGTGG - Intronic
1160486973 18:79302275-79302297 TCCCCGGGGAGGGTGGGGGCAGG - Intronic
1160515253 18:79476010-79476032 TCCAGAAGGGGGGTGGGGCCGGG + Intronic
1160515443 18:79476954-79476976 TCCCAAAGGCGGATGGAGTTCGG + Intronic
1160592799 18:79953148-79953170 TCCCAAAGGCTGCTGGGCTCAGG - Intergenic
1161106174 19:2445165-2445187 TTGCAAAGGCTGGTGGGGGCAGG - Intronic
1161379963 19:3959689-3959711 TCACACTGGCAGGTGGGGGCTGG - Intronic
1162312259 19:9914198-9914220 ACCCAAAGACGGCAGGGGGCCGG + Intronic
1162490663 19:10989432-10989454 TTCCAGAGGCAGGTGGGTGCTGG + Exonic
1162933398 19:13968483-13968505 TCCCAAAGCTGGATGGCGGCAGG - Intronic
1163020076 19:14477076-14477098 TCCAAAAGGCGGGCGGGCACTGG - Intergenic
1163726129 19:18924153-18924175 TCTCAGGGGCGGGTGGGGGCAGG + Intronic
1163987602 19:20968196-20968218 TCCCAGAGCAGGGAGGGGGCAGG - Intergenic
1164698243 19:30262804-30262826 TCCCAGTGGCAGATGGGGGCTGG + Intronic
1165771787 19:38384645-38384667 TCCCAAAGGCAGTTTAGGGCAGG + Intronic
1165894565 19:39133834-39133856 TCCCAGAGGCGGAAGGCGGCCGG + Intronic
1166109701 19:40614452-40614474 TAGCGAAGGCGGGTGGGGGCAGG - Intronic
1166121036 19:40686947-40686969 CCCCACAGGGGGCTGGGGGCAGG + Exonic
1166145507 19:40832045-40832067 TACCAAGGACGGGTGGGGGAAGG - Intronic
1166974886 19:46600258-46600280 TCCTAAACGGGGGAGGGGGCAGG + Intronic
1167079763 19:47270999-47271021 TCCCTAGGGAGGGTGGAGGCAGG + Intronic
1167279498 19:48558579-48558601 TCCCTAAGGAAGGTGGGGCCGGG - Intronic
1167593940 19:50417825-50417847 TCCCGGCTGCGGGTGGGGGCAGG - Exonic
1167899191 19:52605787-52605809 ACCCAAAGCGGGGTGGGGGGTGG - Intronic
1168649688 19:58085362-58085384 TCCAGAAGGCGGGAGGCGGCAGG - Exonic
1168686707 19:58353359-58353381 TCCCTGGGGCGGGAGGGGGCGGG - Intronic
925274002 2:2636224-2636246 GCCCAGAGGCTGGTGAGGGCTGG - Intergenic
925399018 2:3558505-3558527 TCCCGAAGGCGGGCGAGGTCTGG + Exonic
925886810 2:8400662-8400684 TCAGGGAGGCGGGTGGGGGCGGG - Intergenic
925909937 2:8567188-8567210 ACCCAGAGACAGGTGGGGGCAGG - Intergenic
927209141 2:20627997-20628019 TCCCCAAGGCGGGAGGGGCAGGG + Intronic
927704070 2:25286343-25286365 CCCCAAAGCCAGGTGGGAGCCGG + Intronic
927768566 2:25837071-25837093 CTCCAAAGGGGGGTGGGGGGGGG + Intronic
928645470 2:33347560-33347582 TCCCAAAGCTGTGTGGGTGCAGG - Intronic
929227527 2:39525953-39525975 TCCCACTGGCGGGTGGGGTGGGG + Intergenic
929315494 2:40473051-40473073 TCAGAATGGCGGGAGGGGGCGGG + Intronic
932029219 2:68165976-68165998 TCCCAGAAAAGGGTGGGGGCAGG - Intronic
933855991 2:86415029-86415051 TCCCACTGGGGGGTGGGGGCTGG - Intergenic
934652710 2:96101615-96101637 TCCCCTAGGCTGGAGGGGGCTGG - Intergenic
936978810 2:118245038-118245060 TCTCAAAGGCTGGTAGGAGCTGG + Intergenic
937112621 2:119378235-119378257 TCCCTAAAGGGGATGGGGGCGGG + Intergenic
937335439 2:121059510-121059532 TCCAAAAGGCTGGTCGAGGCAGG - Intergenic
937901760 2:127025194-127025216 TCCCAACGGCCGGTTGGGGAGGG - Intergenic
937914176 2:127090748-127090770 GCCCCAAGGCAGGTGGGTGCTGG - Intronic
947049860 2:226030487-226030509 CCCCAAAGGGGGGGGGGGGGTGG + Intergenic
947651079 2:231786639-231786661 TCCCCAAGGCGGGGGCGGGGCGG - Intronic
1169131512 20:3168332-3168354 TCCCACAGGTGGGAGGGGGGAGG + Intronic
1171491188 20:25518746-25518768 TCCAAAAGCAGGGTGGGGGAGGG - Intronic
1173588796 20:44208115-44208137 TGCCCAAGAGGGGTGGGGGCGGG - Intronic
1173959151 20:47057834-47057856 TCCCACAGGTGTGTGGAGGCAGG + Intronic
1174444864 20:50583853-50583875 TCCCAAAGGTGGGGGGCGGGGGG - Exonic
1174461992 20:50689787-50689809 TCCCCAAGGTGGGTGGTGGGGGG + Intronic
1176139723 20:63539692-63539714 TCACCAAGGCAGGAGGGGGCAGG - Intergenic
1177148313 21:17430054-17430076 TCCCAGAGTTGGGTGGGGACTGG - Intergenic
1178536314 21:33413159-33413181 TTCCAGAGGGGGGTGGTGGCAGG - Intronic
1179462670 21:41548233-41548255 CCCCTAAAGCAGGTGGGGGCGGG + Intergenic
1179571138 21:42279542-42279564 CCCAAAAGGCAGGTGGGGCCTGG - Intronic
1179726680 21:43344883-43344905 TGGCAAGGTCGGGTGGGGGCTGG - Intergenic
1180717880 22:17884279-17884301 TTCCACCGGGGGGTGGGGGCAGG + Intronic
1182277555 22:29200295-29200317 TCCCATAAGGGGGTGGAGGCTGG + Intergenic
1182378651 22:29868364-29868386 TCTCAGAGGCTGGTGGGGGTGGG + Intergenic
1182820311 22:33210229-33210251 CCCCAAAGGCCTGTGGAGGCCGG - Intronic
1183364921 22:37401863-37401885 TCGCCAAGGAGGCTGGGGGCGGG - Intronic
1183758139 22:39790010-39790032 ACCCACAGGCAGGAGGGGGCTGG + Intronic
1184019091 22:41808577-41808599 TCCCAGAGACGGGCGGGGGCAGG + Intronic
950161251 3:10762986-10763008 ACCCAAAGGCTGGTGGGAGGGGG - Intergenic
950640133 3:14343443-14343465 GCCCTAAGGCGGGTGGGAGCAGG - Intergenic
954210377 3:49093825-49093847 ACACAACGGCGGGCGGGGGCGGG - Intronic
954374916 3:50189017-50189039 ACCCAAAGGCGGCTGTGGCCTGG - Exonic
954625795 3:52021278-52021300 TCCTAATGGCTGGTGGGGACTGG + Intergenic
954738909 3:52730865-52730887 TGCCAGGGGCTGGTGGGGGCAGG + Intronic
954794920 3:53156618-53156640 TCCCTGAGGCGGGGCGGGGCGGG + Intronic
956685223 3:71820581-71820603 TCCAAAAGGGGGGAGGGAGCAGG + Intergenic
958195257 3:90235494-90235516 GCCCAAAGACTGGAGGGGGCAGG - Intergenic
958897575 3:99846155-99846177 TCCCAAGTGCTGGTGGGGGACGG - Intronic
961330768 3:126136684-126136706 CCCCAGAGGCCAGTGGGGGCAGG + Intronic
961485602 3:127213592-127213614 TCCCATAGCCCGGTGGGGGTGGG - Intergenic
962592764 3:136907341-136907363 TGACAAAGTCTGGTGGGGGCTGG + Intronic
965558299 3:170038734-170038756 TCCCAGTGGCGGGCGCGGGCGGG - Intronic
968264700 3:197353977-197353999 TCCCTAAGGCGGGGGGTGGGGGG + Intergenic
968284370 3:197499359-197499381 CCCTAAGGGCGGGTGGGGGGAGG + Intergenic
968443404 4:636035-636057 GCACAGAGGCGGGTGGTGGCAGG + Intronic
968640517 4:1712326-1712348 ACATAAAGGCGGTTGGGGGCGGG - Exonic
968702781 4:2064681-2064703 TCCCACAGCCAGCTGGGGGCTGG - Exonic
969298373 4:6282647-6282669 TCCCAAAGTGGGCTGGGAGCAGG - Intronic
969417199 4:7068429-7068451 GCGCAAGGGCGGGTGCGGGCCGG - Intergenic
969714774 4:8863197-8863219 TCCCTCAGGCGGGTGGAGGAGGG + Intronic
969760853 4:9180628-9180650 TCATGAAGGTGGGTGGGGGCTGG - Intergenic
970001671 4:11371277-11371299 ATCCTAAGGCGGGTGGGTGCAGG + Intergenic
970371570 4:15412323-15412345 TCCCACAGACTGGTGGGGGTGGG - Intronic
971018891 4:22515425-22515447 ACACAAAGGCGCGTGGGTGCCGG + Intronic
971421571 4:26478116-26478138 CCCCAAATGCCGGTGGGGCCTGG - Intergenic
975521683 4:75308258-75308280 TCCCAAAGACCAGTGGGGACAGG + Intergenic
976202563 4:82594156-82594178 GCCCAAATGTGGTTGGGGGCAGG + Intergenic
977586800 4:98783431-98783453 TTACAAAGGTGGGTGGGGGCAGG + Intergenic
981727663 4:147864296-147864318 TCTCAAAGGCGGGCCAGGGCTGG - Intronic
984821311 4:183885176-183885198 TCTGAAAGGTGGGTGGGGGGCGG - Intronic
985558797 5:571075-571097 ACCCCAAGGCTGGTGGGGGTGGG + Intergenic
985659147 5:1147252-1147274 TCCTAAAGGCGGGGGCGGGGGGG - Intergenic
986061004 5:4191178-4191200 TCCCACCTGCGGGTGGGGGATGG - Intergenic
986643123 5:9891530-9891552 TTCCAAAGGTGGCTGGGGGAGGG + Intergenic
987391198 5:17377086-17377108 TCCCAAAGCCGGCCGGGCGCAGG - Intergenic
989716343 5:44467977-44467999 GCCCACACGCTGGTGGGGGCAGG + Intergenic
990197624 5:53336174-53336196 TCCAAAAGGAGGGAGGGTGCAGG - Intergenic
990378935 5:55202422-55202444 GGCCGAGGGCGGGTGGGGGCAGG + Intergenic
990449948 5:55924646-55924668 CCCCAAGGGCGCGTGGGGGTGGG - Intergenic
991953231 5:71967062-71967084 TCCCAAAGAGGGTTGGGAGCTGG + Intergenic
993038853 5:82788967-82788989 TGCCAAGGGCTGGTGGGGGAAGG + Intergenic
993615979 5:90113116-90113138 TTCCAAAGGAGAGTGGGGGGTGG + Intergenic
994184982 5:96807411-96807433 GCCAAAAGGCGGGGTGGGGCGGG - Intronic
995176886 5:109188289-109188311 TCCCAAAGGAGGGAGGGGGCTGG - Exonic
998131144 5:139651553-139651575 ACCCATAGGAGTGTGGGGGCAGG + Intronic
998417654 5:141957425-141957447 TCCCAAAGGCGAGCAGGAGCTGG - Exonic
999959116 5:156735369-156735391 TCCCAGAGGCAGTGGGGGGCAGG - Intronic
1003160217 6:3627979-3628001 TCCAAAAGGCGGGAGGTGACAGG + Intergenic
1004792321 6:19040486-19040508 TTCCAAAGGCAGCTGAGGGCTGG + Intergenic
1006388983 6:33747662-33747684 GCCCAGAGGCAGGTGGGAGCAGG + Intergenic
1007482234 6:42157765-42157787 TCCCAAGGGAGGGGAGGGGCTGG + Intronic
1012897976 6:104973531-104973553 TCCCAAAGGGGAGTGGGGGGAGG - Intronic
1013988861 6:116229741-116229763 TCCCAATGGTGGGCAGGGGCAGG - Intronic
1016949572 6:149566618-149566640 TCCCACCGGCGGGCAGGGGCGGG + Intronic
1017440449 6:154460040-154460062 TCCCAGGAGGGGGTGGGGGCAGG - Intronic
1019536695 7:1533176-1533198 TCCCACAGGCCGGTGGGGTCTGG + Intronic
1019631972 7:2054187-2054209 ACCCATGGGCGGGTGGGGACAGG + Intronic
1023601838 7:41888200-41888222 TCACAAAGGAGGGTGGGGGTGGG - Intergenic
1025258410 7:57400371-57400393 TCCCAATGGAGGGTGTGGGTAGG + Intergenic
1026086324 7:67266087-67266109 TGCCAAGGGCTGGTGGGGGAGGG - Intergenic
1026690820 7:72548742-72548764 TGCCAAGGGCTGGTGGGGGAGGG + Intergenic
1029307614 7:99631996-99632018 TTCCAAAGGCAGGTGGGGACTGG + Exonic
1029392927 7:100287588-100287610 AGCAAAAGGCGGGTGGGAGCAGG + Intergenic
1029652524 7:101903239-101903261 TACACAAGGCGGGTGGTGGCGGG + Intronic
1029746472 7:102517924-102517946 TCCCCAGGGCGGGGAGGGGCCGG + Intergenic
1029764409 7:102616903-102616925 TCCCCAGGGCGGGGAGGGGCCGG + Intronic
1030156776 7:106463310-106463332 TCCCAGAGGAGGATGGGGGAGGG + Intergenic
1032314493 7:130822145-130822167 TCTCAAAAGCGGCTGGGGGAAGG - Intergenic
1033558334 7:142508219-142508241 GGCCACAGGAGGGTGGGGGCTGG - Intergenic
1035833941 8:2728072-2728094 GCCCACAGCCGGGAGGGGGCGGG - Intergenic
1036270962 8:7302479-7302501 TCATGAAGGTGGGTGGGGGCTGG - Intergenic
1036350387 8:8007865-8007887 TCATGAAGGTGGGTGGGGGCTGG + Intergenic
1038038709 8:23706598-23706620 TCCCGAAGGCGGATGGGGCGGGG + Exonic
1038937973 8:32273299-32273321 TCCAAAAGTCGGGAGGGGGTTGG - Intronic
1045417290 8:101980046-101980068 GCCAAAATGGGGGTGGGGGCAGG + Intronic
1045798545 8:106075211-106075233 TCCCATTTGGGGGTGGGGGCAGG + Intergenic
1048796047 8:138151259-138151281 TCCCAAAGGCTGATGGGTGATGG + Exonic
1048883873 8:138892852-138892874 TGCCCATTGCGGGTGGGGGCTGG + Intronic
1051058775 9:13021220-13021242 TACCAGAGGCTGGTGGGGGGGGG + Intergenic
1051449375 9:17178498-17178520 TCCCACAGCAGGGCGGGGGCGGG + Intronic
1053203132 9:36166147-36166169 TCCCAAAGGCTGGTCCGGGTGGG + Intergenic
1053472953 9:38359839-38359861 TCCCCAGGGCTGGTGGAGGCAGG + Intergenic
1055440941 9:76335296-76335318 TCCCCAGGGCTGGTGGGGGGAGG + Intronic
1055530438 9:77177920-77177942 ACCCACAGGCGGGCGGCGGCAGG - Intronic
1057198180 9:93126657-93126679 TCAGCAAGGCGGGTGGGGGAGGG + Intronic
1057704336 9:97386847-97386869 TCCCACTGGAGGGTGGGGGTAGG - Intergenic
1057744754 9:97741945-97741967 TCCCAAAGGCCGGTGCGGGGAGG + Intergenic
1057747201 9:97761876-97761898 TCCCAAAGGCGAGGAGGGCCAGG + Intergenic
1058275668 9:103038264-103038286 GGACAAAGCCGGGTGGGGGCTGG - Intergenic
1058908179 9:109498119-109498141 CCCCAGGGACGGGTGGGGGCGGG + Intronic
1059626864 9:116076631-116076653 TGCCAAAGGAGTGTGGGGGAGGG - Intergenic
1060406347 9:123374912-123374934 TCCCACAGGCGGGCTGAGGCTGG - Intronic
1061257473 9:129460898-129460920 TGCCAAAGGCTTGTGGGGGTGGG - Intergenic
1061497383 9:130982762-130982784 GCCCAAAGGAGGCTGGGGCCAGG - Intergenic
1062395229 9:136350129-136350151 CAACAAAGGAGGGTGGGGGCTGG - Intronic
1185662935 X:1741445-1741467 GGCCAAGGGGGGGTGGGGGCGGG + Intergenic
1186500031 X:10043786-10043808 TCTCAAAAGTGGATGGGGGCCGG + Intronic
1187205269 X:17175863-17175885 TCAGAAAGGCAGGTGGGGGAAGG + Intergenic
1187571940 X:20513344-20513366 TACCAAAGTGGGGTGGGGGAAGG - Intergenic
1189354240 X:40299153-40299175 TGGCAAAGTGGGGTGGGGGCAGG - Intergenic
1192559334 X:72115412-72115434 TCCCGAAGTTTGGTGGGGGCGGG + Intergenic
1192796264 X:74426049-74426071 TCCCAAGGTTGGGTGGGGCCAGG + Intronic
1195945723 X:110209079-110209101 TTCCAAAGGCTAGTGGGGACAGG + Intronic
1201232729 Y:11880225-11880247 TCCCAGAGGAAGGTGTGGGCTGG - Intergenic