ID: 900207183

View in Genome Browser
Species Human (GRCh38)
Location 1:1436552-1436574
Sequence CTCTGAAAGCCATGCCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 209}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900207176_900207183 22 Left 900207176 1:1436507-1436529 CCTGCAGGCTGAGCTGCGTGGCT 0: 1
1: 0
2: 1
3: 24
4: 357
Right 900207183 1:1436552-1436574 CTCTGAAAGCCATGCCTGGAGGG 0: 1
1: 0
2: 1
3: 26
4: 209
900207178_900207183 -6 Left 900207178 1:1436535-1436557 CCAGCCTCAGGCTGCTCCTCTGA 0: 1
1: 0
2: 3
3: 49
4: 466
Right 900207183 1:1436552-1436574 CTCTGAAAGCCATGCCTGGAGGG 0: 1
1: 0
2: 1
3: 26
4: 209
900207174_900207183 27 Left 900207174 1:1436502-1436524 CCTCACCTGCAGGCTGAGCTGCG 0: 1
1: 0
2: 2
3: 41
4: 316
Right 900207183 1:1436552-1436574 CTCTGAAAGCCATGCCTGGAGGG 0: 1
1: 0
2: 1
3: 26
4: 209
900207179_900207183 -10 Left 900207179 1:1436539-1436561 CCTCAGGCTGCTCCTCTGAAAGC 0: 1
1: 0
2: 3
3: 48
4: 663
Right 900207183 1:1436552-1436574 CTCTGAAAGCCATGCCTGGAGGG 0: 1
1: 0
2: 1
3: 26
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900207183 Original CRISPR CTCTGAAAGCCATGCCTGGA GGG Intronic
900207183 1:1436552-1436574 CTCTGAAAGCCATGCCTGGAGGG + Intronic
901391578 1:8949513-8949535 CTGTGCAAGCCATTCCTGGCAGG - Intronic
902435160 1:16393665-16393687 CTCTGAAAGCCTTGCCAGGGAGG + Intronic
904246770 1:29193678-29193700 CCCTGAAAGCAAAGCCTGGGTGG - Intronic
906592975 1:47045642-47045664 CTCCTAAAACCATTCCTGGAGGG - Intronic
910836244 1:91515396-91515418 TTATGAAAGCCAAGCCTTGAAGG - Intronic
913581884 1:120234487-120234509 AACTCAAAGCCATGCCTTGAGGG + Intergenic
913626291 1:120663902-120663924 AACTCAAAGCCATGCCTTGAGGG - Intergenic
914563815 1:148845934-148845956 AACTCAAAGCCATGCCTTGAGGG + Intronic
914609012 1:149284292-149284314 AACTCAAAGCCATGCCTTGAGGG - Intergenic
915903093 1:159860431-159860453 CTATGGAAGCCCTGCCAGGAAGG + Intronic
916920343 1:169460067-169460089 CTCTGAAAGACTTTTCTGGAGGG + Intronic
920094208 1:203475449-203475471 CTGTGTAAGCCAGGACTGGATGG - Intergenic
920390339 1:205596328-205596350 CTCTGGTCCCCATGCCTGGATGG - Intronic
923086862 1:230708866-230708888 CTTTGAACGCCATGCTTGGTAGG - Intronic
923336850 1:232978071-232978093 CTCTAAAAGAAACGCCTGGAAGG - Intronic
924192069 1:241564189-241564211 CTCTGTAAGCTATACATGGAAGG + Intronic
924600649 1:245485788-245485810 CTCTGAAAGCCTTGCCCTGCAGG - Intronic
1062893423 10:1084135-1084157 GTCTGACAGCCAGGCATGGAAGG - Intronic
1064115317 10:12572574-12572596 CTGTGAAAGTCCTGGCTGGAGGG + Intronic
1067411815 10:46071202-46071224 CTCTGTAAGCCCAGGCTGGAGGG - Intergenic
1069866289 10:71505295-71505317 CTCTGAAAGTCAAGCCAGAAAGG + Intronic
1070899735 10:80017793-80017815 CTTTTCAAACCATGCCTGGAGGG + Intergenic
1071368777 10:84928774-84928796 CTCCGATAGCCTTGACTGGATGG + Intergenic
1071567144 10:86677161-86677183 CCCTGAAGGCCAGGCCTGCATGG + Intronic
1072247638 10:93557390-93557412 CTCTGAGAGCCATTGCTGGAGGG + Intergenic
1072607331 10:96995775-96995797 CACTGAAATCCAAGCTTGGAAGG + Intergenic
1072800806 10:98391068-98391090 CTCAGGAAGCCACTCCTGGAAGG + Exonic
1074894558 10:117763767-117763789 CTCTGACAGCCCTGCCAGGTTGG - Intergenic
1075071051 10:119320105-119320127 CAGAGAAAGCCATGCCTGTAGGG + Intronic
1075287231 10:121197421-121197443 CTCTGAAAGTCATACATGAAGGG + Intergenic
1075326855 10:121540000-121540022 CTATGCAAGCCATGACTGCAGGG + Intronic
1075428578 10:122362316-122362338 CTCTCATAGCCATGCTAGGAGGG - Intergenic
1075819831 10:125297294-125297316 CTCTGAGAGCCTGGCATGGAAGG - Intergenic
1076746000 10:132514893-132514915 CTCCGGAAGCCCTGGCTGGATGG + Intergenic
1077450583 11:2640824-2640846 CTGTGAAAGGTATGTCTGGAGGG - Intronic
1077480192 11:2810997-2811019 CTCTGAATGCCATGCTGGGAAGG - Intronic
1080128978 11:28770725-28770747 CTCAGACAGCCCTGCCTGTATGG - Intergenic
1081736855 11:45410378-45410400 CTCTGAAAGGCAACCCTGGAGGG + Intergenic
1081764457 11:45599790-45599812 CTAGGACAGCCATCCCTGGACGG + Intergenic
1081867466 11:46367483-46367505 CTGGGAGAGCCAAGCCTGGAAGG + Intronic
1081930258 11:46865161-46865183 CTCTGAAAGGGATGCCAGGCTGG - Exonic
1082203803 11:49406028-49406050 CACTGAAAGTAAAGCCTGGAGGG + Intergenic
1082792902 11:57359466-57359488 CTCTGACAGGCGTGGCTGGAAGG - Intronic
1082851164 11:57766066-57766088 CTCTGCAAGCCCAGTCTGGAGGG - Intronic
1085519746 11:77130978-77131000 CTCCCAAAGCCAGGCCAGGAAGG + Intronic
1086651287 11:89294406-89294428 CTCTGAAAGTAAAGCCTGGAGGG - Intronic
1088322859 11:108571196-108571218 CTTTTAAAGACTTGCCTGGATGG + Intronic
1088639487 11:111857682-111857704 CGTTGATAGCCATGACTGGATGG - Exonic
1089664726 11:120010984-120011006 CGCTGAAAGCCTTGTCTGGCTGG - Intergenic
1090475678 11:127018048-127018070 CTCTGAAAGTCCAGCCTGGTAGG - Intergenic
1090773165 11:129939727-129939749 ATCTGAAAGCCATGCAAGGCTGG + Intronic
1091719769 12:2804102-2804124 CTCAGGAAGCCATGCATGGTGGG - Exonic
1092180177 12:6441523-6441545 CTCTCAAAGCCTTGCTGGGAAGG + Intergenic
1092285932 12:7129352-7129374 CTCTGAGAGCCAGGCCTACAGGG - Intergenic
1093994505 12:25627254-25627276 CTCTGAAAGGCATCCATGGAGGG + Intronic
1094450476 12:30578382-30578404 CTCTGGATGCACTGCCTGGAAGG + Intergenic
1096749520 12:53749898-53749920 CTCTGAAAGGCAATCCTGAAGGG + Intergenic
1100595714 12:96070246-96070268 GTCTGAAAGCCATCACTGTAAGG - Intergenic
1103421072 12:120783237-120783259 CTCTGAAAGTCATTGCTGCACGG - Intronic
1104778083 12:131403045-131403067 CACTGAAAGCCATGTCTGGGAGG + Intergenic
1105635605 13:22212623-22212645 CTCTAAAAGCTATGCCATGAGGG + Intergenic
1106170017 13:27280725-27280747 CTTTGAAAGCCATTCTAGGATGG + Intergenic
1106870983 13:34020482-34020504 CTCAGGCAGCCTTGCCTGGAAGG + Intergenic
1112914726 13:104534234-104534256 ATCTGAAAGCCTTGACTAGAAGG - Intergenic
1114084336 14:19228546-19228568 TTCTAAAAGCCATACCTGAAGGG + Intergenic
1114972404 14:28049610-28049632 TTCTGAGAGCCTTGCCTGGAAGG + Intergenic
1118047509 14:61987301-61987323 CTCAGAAGGCCATCCCTGGTTGG - Intergenic
1118265577 14:64291184-64291206 CTGTCAAACCCAGGCCTGGAAGG - Intronic
1118326369 14:64784188-64784210 CTCAGATAGGCTTGCCTGGATGG - Intronic
1119262170 14:73244415-73244437 AGCTGAGAGCCAGGCCTGGAGGG - Intronic
1119325261 14:73756136-73756158 CTCAGAACGCCGTTCCTGGATGG - Intronic
1119783978 14:77298720-77298742 CCCTGAAAGCCGGGCCTGGAAGG + Exonic
1121015195 14:90544774-90544796 CCAAGAAAGCCATGCCAGGAAGG - Intronic
1122282347 14:100630695-100630717 CTCTGAAAGTCGCCCCTGGAAGG - Intergenic
1122288450 14:100666709-100666731 CTCTGCAATGCCTGCCTGGATGG - Intergenic
1123124552 14:105937223-105937245 CTTAAAAACCCATGCCTGGATGG + Intergenic
1202895946 14_GL000194v1_random:10408-10430 TTCTAAAAGCCATACCTGAAGGG + Intergenic
1124699988 15:31904369-31904391 CTCTGGGAGCCCTGCGTGGAGGG + Intergenic
1125089819 15:35777195-35777217 CTCTGCAAGCCATGCATCGGGGG - Intergenic
1127318302 15:57817907-57817929 CTCTGAAAGCCAGGCCTGCCAGG - Intergenic
1127454564 15:59145137-59145159 CTTTGAAAGTCATTCCTGGCCGG - Intronic
1127734331 15:61827852-61827874 CCCTGGAAGCCAAGCCAGGAGGG - Intergenic
1129254984 15:74329338-74329360 GTCTGAAATCCAGGCCTGCAGGG - Intronic
1130140426 15:81221590-81221612 CTCTCGATGCCAGGCCTGGAGGG + Intronic
1131146963 15:90020381-90020403 CTGGGACAGCCCTGCCTGGACGG - Intronic
1131809638 15:96159226-96159248 CTCTGAATTCCATGCCTGGTCGG - Intergenic
1133016079 16:2941360-2941382 CACTGAAAGCCGTGCTTAGAGGG + Intronic
1133282341 16:4673884-4673906 TTCTGCAAGCCTTGCCTGGCTGG - Intronic
1134558989 16:15191253-15191275 CTCTGAAAGCTCTGCCTTCAAGG - Intergenic
1134919524 16:18102866-18102888 CTCTGAAAGCTCTGCCTTCAAGG - Intergenic
1135235026 16:20747176-20747198 CTCTGGAACCCATCCCTTGAGGG - Intronic
1136064796 16:27751377-27751399 CTCAGAGTGCCTTGCCTGGAAGG - Intronic
1136597265 16:31260055-31260077 CTCTGAGAGCCATGGCTGGAAGG - Exonic
1140036279 16:71373592-71373614 CTCTGAGAACCAGTCCTGGATGG - Intronic
1143272771 17:5688256-5688278 CTCCTGAAGCCAGGCCTGGAAGG - Intergenic
1144312512 17:14025801-14025823 TTCTAAAAGCCATACCTGAAAGG - Intergenic
1144332240 17:14235524-14235546 TTCTAAAAGCCATACCTGAAAGG + Intergenic
1145161965 17:20581039-20581061 TTCTAAAAGCCATACCTGAAAGG - Intergenic
1147124069 17:38353299-38353321 CTTAAAAAGCCATGCCAGGATGG - Intronic
1149671028 17:58410321-58410343 CTCTAAAAGCCATGTCAGGAAGG + Intronic
1151593837 17:75064758-75064780 CTCTGAAAGATACGACTGGATGG - Exonic
1151988247 17:77557741-77557763 CTTGGAAAGGCCTGCCTGGAAGG - Intergenic
1152931151 17:83110519-83110541 TTCTGAAAGAAATGCCCGGAAGG - Intergenic
1152943005 17:83182230-83182252 CTCAGCAAGCCCTTCCTGGAGGG - Intergenic
1154122823 18:11665368-11665390 CTTTGGAAGCCATGGCTGGCTGG - Intergenic
1156887841 18:42156292-42156314 CTCTGAAAGGGATATCTGGATGG - Intergenic
1157093149 18:44660297-44660319 ATCTGGAAACCAAGCCTGGAGGG - Intergenic
1157176849 18:45459690-45459712 CTCTGAATGTCAGGCCAGGAGGG - Intronic
1157677995 18:49581635-49581657 CTCTGAAAGGCATGCCTGCCCGG - Exonic
1161300367 19:3539542-3539564 CTCTGAAATCCAGGCCTGTGCGG + Intronic
1161376113 19:3939809-3939831 CTCTGAAAGCCAAGGCTGGGGGG + Intronic
1161405187 19:4087604-4087626 CACTGAAAGCCAGGCCTTGGGGG - Intergenic
1166714942 19:44960972-44960994 CTCTGAATGCCAGGTTTGGAAGG - Intronic
1167308995 19:48725610-48725632 CTCTGAGTGCCCTTCCTGGAAGG - Intronic
925082234 2:1079286-1079308 CACAGAAAGCAGTGCCTGGAGGG + Intronic
925196014 2:1926389-1926411 CTCAGAAAAGCATACCTGGAAGG - Intronic
926549950 2:14289064-14289086 AGCTGAGAGCCATGCCTGGGTGG - Intergenic
929481875 2:42316070-42316092 CTGTGAATGCCATGCTTGGGAGG - Intronic
933808645 2:86018227-86018249 CTCTGAAGGCCTGGCCTGGGCGG - Intergenic
934525391 2:95048566-95048588 CTCTGGCAGCCCTGCTTGGAAGG - Intronic
935330173 2:101971407-101971429 CTCTGATATCCCAGCCTGGAAGG - Intergenic
937265970 2:120614841-120614863 GTCAGAAAGCCCTGCCTGGGCGG - Intergenic
938495312 2:131794808-131794830 TTCTAAAAGCCATACCTGAAGGG + Intergenic
940857416 2:158740271-158740293 CTCTGGAAACCAGGACTGGAAGG + Intergenic
942605848 2:177689880-177689902 CTGTGTAAGCCATGGCTAGAAGG + Intronic
946299275 2:218812704-218812726 TTCTGGAAGCGATACCTGGATGG + Exonic
947154166 2:227144819-227144841 CTCTGAAAGTGAGACCTGGAGGG + Intronic
948257467 2:236578477-236578499 CTCTGAAAGCCTTCCATGGAGGG - Intronic
948720399 2:239895924-239895946 CACTGAAAACAATGCATGGACGG - Intronic
1168790762 20:574421-574443 CCCTGCAAGCCAGGCCTAGAAGG + Intergenic
1168836396 20:880633-880655 GTCTGAGAGCCAGGCCTAGAAGG - Intronic
1172342158 20:34166932-34166954 CTTTGAAATCCTGGCCTGGAGGG - Intergenic
1173223929 20:41150776-41150798 CTGTAAAAGCCAGGTCTGGAGGG - Intronic
1173438077 20:43050436-43050458 CTGTGAACGCCCTGCCTGGGTGG - Intronic
1174579047 20:51557992-51558014 CTCTGACTGCCCAGCCTGGATGG - Intronic
1175154442 20:56960417-56960439 CTCTGAAGGCCATGCAAGGCAGG + Intergenic
1175642322 20:60641212-60641234 CTTTGCAAACCAGGCCTGGAGGG + Intergenic
1175726940 20:61324968-61324990 CACTCACAGCCATGCCTGCAGGG + Intronic
1176028822 20:63000409-63000431 CTCTGAGGGGCATGCATGGAAGG - Intergenic
1176615635 21:9026460-9026482 TTCTAAAAGCCATACCTGAAGGG + Intergenic
1176709539 21:10137344-10137366 TTCTAAAAGCCATACCTGAAGGG - Intergenic
1178695513 21:34789760-34789782 CTCTCAAAGCCATGTGTGGAGGG - Exonic
1178950130 21:36979236-36979258 CTCTGTCACCCAGGCCTGGAGGG - Intronic
1179715375 21:43283942-43283964 CTCTGAAATGGATGCATGGATGG - Intergenic
1180293636 22:10864657-10864679 TTCTAAAAGCCATACCTGAAGGG - Intergenic
1180496441 22:15894072-15894094 TTCTAAAAGCCATACCTGAAGGG - Intergenic
1183583267 22:38738075-38738097 CTCTGAACCCCATGCCTGGCAGG + Intronic
1184618004 22:45651215-45651237 CTTTCAAAGCCATCCCTGGATGG + Intergenic
949433328 3:4002129-4002151 CTCTGAATGCCATTCTTGGTAGG + Intronic
949562260 3:5213823-5213845 CTTTCAAGGCCTTGCCTGGAGGG + Intronic
950678885 3:14571350-14571372 CAGTGACAGCCATGCCTGGAGGG - Intergenic
955188929 3:56742047-56742069 CTCTGAAAGCCCTGACTGTCTGG + Intronic
956314288 3:67916734-67916756 CTCTGAAACCCATAGTTGGATGG + Intergenic
956647559 3:71471699-71471721 CCCTGAAAGCCATACCTTCAAGG + Intronic
956899723 3:73702674-73702696 ATCTGAAAGCTGTGCCTGCATGG + Intergenic
960396707 3:117146502-117146524 TTCTGAAAGCCAAGGCTGGTAGG - Intergenic
961991252 3:131194098-131194120 CTCTGAAATCCATGCCACTAGGG - Intronic
962410999 3:135141772-135141794 CTCTGAGAGCCCTGCCTCCATGG - Intronic
963298866 3:143577290-143577312 ATCTGGAAGACATGCCTGGGAGG - Intronic
964679984 3:159327858-159327880 TTCTTCAAGCCAGGCCTGGAGGG + Intronic
964729601 3:159850975-159850997 CTTTAAAAGCTATGCTTGGATGG + Intronic
965537737 3:169841367-169841389 ATCTGAAAGCCATGCGTGTGAGG - Intronic
967147202 3:186616361-186616383 CTTTGACAGCCGTGCCTGGAGGG + Intronic
968544475 4:1191737-1191759 CTGTGTAGGCCCTGCCTGGAGGG + Intronic
969209801 4:5678068-5678090 CTCTGAAAGCCCTTCCTGTAGGG + Intronic
970118125 4:12722212-12722234 CTCTGAGACCCATGCCTTGTAGG - Intergenic
975945271 4:79697777-79697799 CTCTGAGAGCCTGGCCTGTATGG - Intergenic
977146031 4:93440963-93440985 ATCTAAGAGCCATTCCTGGATGG - Intronic
979113319 4:116787750-116787772 CTCTGAATGCCATTCCCTGAAGG - Intergenic
980158609 4:129134406-129134428 TTCTAAAAGCCATACCTGAAAGG - Intergenic
983183985 4:164679925-164679947 ATTTGAAAGCCATGGGTGGAAGG - Intergenic
985051613 4:185997711-185997733 CTCAGAAAGCCATCCCTAGGTGG + Intergenic
987391027 5:17375595-17375617 CTCTGGAGGTCATGCCTGGCAGG - Intergenic
988503521 5:31802443-31802465 CTCCGAAAGAAATGCTTGGATGG + Intronic
988979644 5:36553887-36553909 CTCTCAAATCCCTGCCTGCAGGG + Intergenic
996212452 5:120828099-120828121 CTCATGAAGCCATGCCTCGACGG + Intergenic
998445400 5:142194634-142194656 CTCTGGATGACATGCCTGTAGGG + Intergenic
999272236 5:150303134-150303156 CTCTGAGTGCCAGCCCTGGAAGG + Intronic
1002195465 5:177498596-177498618 CTCTTGAAGCCATGCCAGGCGGG + Intergenic
1003387671 6:5684116-5684138 CTCTGAAAGGCAAGCCGGGCAGG - Intronic
1003474811 6:6471594-6471616 CTCAGTAAGCAATGACTGGAGGG + Intergenic
1003502897 6:6716930-6716952 CTCTGAACCCCATGCTTCGAAGG + Intergenic
1004083770 6:12423200-12423222 CTCTGGAAGCAATGTCTGAAGGG + Intergenic
1004619426 6:17320184-17320206 CTCTGAGCGCCAGGCGTGGAGGG + Intergenic
1005455520 6:26016495-26016517 CTCTGAAAGCCCCGCCAGGTAGG - Intergenic
1008714697 6:54274416-54274438 CTCAGAGACCCATGCCTAGAGGG + Intergenic
1010678831 6:78775628-78775650 CTCTTAAAGTGATGCCTGAATGG + Intergenic
1012002429 6:93669422-93669444 CTCTCAAAGACCTACCTGGAAGG + Intergenic
1018570029 6:165199941-165199963 AACTGAAAGGCATGCCAGGAGGG - Intergenic
1019709047 7:2510055-2510077 CTCGGAAAGCCCTGCCAGGCTGG - Intergenic
1020062093 7:5160338-5160360 CTCTGAAATCCATCCGTGGAGGG + Intergenic
1020166051 7:5808339-5808361 CTCTGAAATCCATCCGTGGAGGG - Intergenic
1021315124 7:19139205-19139227 CTCTGAAATCCTTGTCTGGGTGG + Intergenic
1022860023 7:34358037-34358059 CTCTGAGGACCAGGCCTGGAAGG + Intergenic
1024219349 7:47275836-47275858 CTCATGAAGCCATGCCTCGACGG - Exonic
1024358944 7:48447564-48447586 CTTTGACAGCCATGCCTAGTGGG - Intronic
1027692393 7:81364519-81364541 CTTTGGAAGTCATTCCTGGAAGG - Intergenic
1030063154 7:105639119-105639141 CCCTGAAAGGCAGCCCTGGAGGG - Intronic
1030483122 7:110129506-110129528 CACTGTAAGTCATGGCTGGATGG - Intergenic
1031180546 7:118409215-118409237 CAATCAAAGCCTTGCCTGGATGG - Intergenic
1034282454 7:149863702-149863724 GGCTGAGAGCCCTGCCTGGAAGG - Intronic
1034396680 7:150831314-150831336 CTCTGAAAGCACTGCCAGGGTGG + Intronic
1034413898 7:150955204-150955226 CTCTGTAAGCCCAGCCTGGGAGG + Intronic
1037118990 8:15260551-15260573 GTAAGAAAGCCATGGCTGGAAGG + Intergenic
1039791513 8:40879536-40879558 CTAGGAAATCCATGCCAGGACGG + Intronic
1040496177 8:47967381-47967403 CTCCGGAAGACATGCCTGCAGGG + Exonic
1040895059 8:52358195-52358217 CACTGAAAGCCATGCTAGGAGGG + Intronic
1045852926 8:106724738-106724760 CTCAGAAACACATGGCTGGAAGG + Intronic
1046247579 8:111585054-111585076 CTCTGAAATCTATGCCTATAAGG + Intergenic
1047785297 8:128148552-128148574 CTCTGAAAGCCATTCTTTCATGG - Intergenic
1048234455 8:132675832-132675854 GTCTGGAAGGCAAGCCTGGAAGG - Intergenic
1049310102 8:141929361-141929383 GTCTGAAAGCGAGGCCTGCAGGG - Intergenic
1052603467 9:30670437-30670459 TTCTAAAAGCCATACCTGAAAGG + Intergenic
1053174453 9:35911960-35911982 CTCTGAAGGCCCTGCGTCGAGGG - Intergenic
1053646512 9:40122880-40122902 TTCTAAAAGCCATACCTGAAGGG - Intergenic
1054327523 9:63720782-63720804 TTCTAAAAGCCATACCTGAAGGG - Intergenic
1054538058 9:66253093-66253115 TTCTAAAAGCCATACCTGAAGGG + Intergenic
1057498851 9:95581261-95581283 CTCCGAAAGCCAGGCCTTGAGGG + Intergenic
1059526252 9:114993336-114993358 CTCAGGAAGCCATGCAGGGAAGG + Intergenic
1060588068 9:124799219-124799241 CTCTGAACCCCTAGCCTGGAGGG - Intronic
1060929957 9:127483091-127483113 CTCTGTTGGCCATGCATGGAGGG + Intronic
1061234422 9:129334332-129334354 CCCTGAAGGCTCTGCCTGGAAGG + Intergenic
1202794298 9_KI270719v1_random:106311-106333 TTCTAAAAGCCATACCTGAAGGG - Intergenic
1185951555 X:4441087-4441109 CTCTAAATGCAATTCCTGGAGGG + Intergenic
1186265986 X:7834279-7834301 CTCTAATAGCAATGCCAGGAAGG + Intergenic
1189375753 X:40465248-40465270 CTCTGAGAGCCATGGATGAAGGG + Intergenic
1190024207 X:46907830-46907852 CTTTGAAAGCCCTGCATGCAAGG - Intergenic
1194407631 X:93517043-93517065 ATCTCAAAGCCATGTCTGCATGG + Intergenic
1194473940 X:94335513-94335535 CCCTTTAAGCCATGGCTGGAGGG - Intergenic
1198522085 X:137463261-137463283 CTCTGAAAGTCAAGCTTGGAAGG - Intergenic
1199500217 X:148500061-148500083 CGCCTAAAGGCATGCCTGGAGGG + Intergenic
1201149023 Y:11085115-11085137 TTCTAAAAGCCATACCTGAAGGG + Intergenic
1202045135 Y:20730117-20730139 CACTGCAACCCATGCCTGGCTGG - Intergenic
1202239745 Y:22754320-22754342 CTCTGAAATCTCTCCCTGGAAGG - Intergenic
1202392731 Y:24388082-24388104 CTCTGAAATCTCTCCCTGGAAGG - Intergenic
1202478052 Y:25282035-25282057 CTCTGAAATCTCTCCCTGGAAGG + Intergenic