ID: 900207212

View in Genome Browser
Species Human (GRCh38)
Location 1:1436647-1436669
Sequence GTGAGGAATGGGAAGGTGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 744
Summary {0: 1, 1: 0, 2: 5, 3: 68, 4: 670}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900207206_900207212 -7 Left 900207206 1:1436631-1436653 CCTGCTTGCAGGGTCTGTGAGGA 0: 1
1: 0
2: 1
3: 19
4: 182
Right 900207212 1:1436647-1436669 GTGAGGAATGGGAAGGTGTGGGG 0: 1
1: 0
2: 5
3: 68
4: 670
900207201_900207212 11 Left 900207201 1:1436613-1436635 CCAGGACTCTTGGCTCCACCTGC 0: 1
1: 0
2: 2
3: 46
4: 326
Right 900207212 1:1436647-1436669 GTGAGGAATGGGAAGGTGTGGGG 0: 1
1: 0
2: 5
3: 68
4: 670
900207204_900207212 -4 Left 900207204 1:1436628-1436650 CCACCTGCTTGCAGGGTCTGTGA 0: 1
1: 0
2: 1
3: 24
4: 219
Right 900207212 1:1436647-1436669 GTGAGGAATGGGAAGGTGTGGGG 0: 1
1: 0
2: 5
3: 68
4: 670
900207198_900207212 25 Left 900207198 1:1436599-1436621 CCTGGGGGCCTAGGCCAGGACTC 0: 1
1: 0
2: 2
3: 22
4: 256
Right 900207212 1:1436647-1436669 GTGAGGAATGGGAAGGTGTGGGG 0: 1
1: 0
2: 5
3: 68
4: 670
900207196_900207212 30 Left 900207196 1:1436594-1436616 CCTGTCCTGGGGGCCTAGGCCAG 0: 1
1: 0
2: 3
3: 35
4: 281
Right 900207212 1:1436647-1436669 GTGAGGAATGGGAAGGTGTGGGG 0: 1
1: 0
2: 5
3: 68
4: 670
900207200_900207212 17 Left 900207200 1:1436607-1436629 CCTAGGCCAGGACTCTTGGCTCC 0: 1
1: 0
2: 2
3: 42
4: 388
Right 900207212 1:1436647-1436669 GTGAGGAATGGGAAGGTGTGGGG 0: 1
1: 0
2: 5
3: 68
4: 670

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900207212 Original CRISPR GTGAGGAATGGGAAGGTGTG GGG Intronic
900166105 1:1244935-1244957 GAGAGGAATGGGGAGGAGTGGGG - Intronic
900207212 1:1436647-1436669 GTGAGGAATGGGAAGGTGTGGGG + Intronic
900315103 1:2052418-2052440 GGGAGGAAGAGGAAGGGGTGGGG - Intronic
900914587 1:5627122-5627144 GTGAGGGAAGGGAATGTGGGAGG + Intergenic
901648473 1:10729100-10729122 GGGAGGAGAGGGAAGGGGTGGGG + Intronic
901700305 1:11041735-11041757 GTGAAGAATGGGTGGGTGGGTGG + Intronic
901928690 1:12583351-12583373 GTGAGGAATGGATGGGTGGGTGG - Intronic
902534230 1:17110008-17110030 CTGGGGAATAGGAGGGTGTGGGG - Intronic
902619151 1:17640342-17640364 GTGTGGAACGGGGAGGTTTGGGG + Intronic
902812707 1:18897938-18897960 GCCAGGAAAGGGAAGGTTTGGGG + Intronic
903344836 1:22677374-22677396 GTGTGGGAAGGGAAGGCGTGGGG - Intergenic
903737046 1:25536474-25536496 ACGAGGGATGGGAAGGTGGGTGG + Intergenic
904035765 1:27557760-27557782 GTGTGTACTGGGCAGGTGTGGGG - Intronic
904345239 1:29863772-29863794 GTGTGGGAAGGGAAGGGGTGGGG + Intergenic
904565803 1:31427678-31427700 GTGAGGATGAGGATGGTGTGAGG - Intronic
904897058 1:33825192-33825214 GAGAGGACTGGGGAAGTGTGGGG - Intronic
905018155 1:34791563-34791585 CTGAGGAAAGGGAAGGTGGCAGG - Intronic
905296087 1:36955271-36955293 GACAGGAAGGGGCAGGTGTGGGG + Intronic
905408590 1:37753523-37753545 ATGGGGGATAGGAAGGTGTGAGG + Intronic
905633008 1:39529418-39529440 CTGAGGAAGTGGCAGGTGTGCGG + Intergenic
905883841 1:41481271-41481293 GTGGGGATGGGGAAGGGGTGGGG - Intronic
905892883 1:41528205-41528227 GGGTGGAGTGTGAAGGTGTGAGG - Intronic
906061769 1:42953570-42953592 GTGAGGTGGGGGAAGGGGTGAGG + Intronic
906083165 1:43107560-43107582 GTGGGGAATGGGGGGGTGTGGGG + Intergenic
906201689 1:43964580-43964602 GTGGGGAATGGGAAAGGGAGGGG + Intronic
907608947 1:55848298-55848320 GTGAGGGATGGAACGGGGTGTGG + Intergenic
907637749 1:56153164-56153186 GTGAGGGTTGGGAAGGGGTGGGG + Intergenic
909583790 1:77266666-77266688 GAGAGGAATAGGAAGTTCTGGGG + Intergenic
910519733 1:88106141-88106163 GTGAGGAGTGGGAAAGAGAGAGG - Intergenic
910698632 1:90048643-90048665 CTGAGGGCTGGAAAGGTGTGTGG + Intergenic
911138317 1:94467306-94467328 CTGTGGGATGGGAAGGTTTGGGG - Intronic
911191261 1:94950696-94950718 GAAAAGAAAGGGAAGGTGTGTGG - Intergenic
911193217 1:94968601-94968623 GAGAAGAATAGGAAAGTGTGTGG - Intergenic
911392018 1:97256947-97256969 GTGTGAAGTGGGAAGGTGGGTGG - Intronic
911657381 1:100460529-100460551 GTGAGGAATGGGGAGGAGAAGGG - Intronic
911748563 1:101468612-101468634 CTGAGGAATGGGAAGGGGAAGGG + Intergenic
911804212 1:102185329-102185351 GGGAGGAAAGGGAGGGAGTGAGG - Intergenic
912052632 1:105549187-105549209 GTGAGGTATGGGGAGGGGGGAGG - Intergenic
912308513 1:108595569-108595591 GGGAGGAAAGGGAGGGTGGGAGG + Intronic
912687228 1:111777109-111777131 GTTAGAATTGGGCAGGTGTGTGG + Exonic
913550445 1:119912512-119912534 GTGGGGAAGGGAAAGGTATGAGG - Exonic
914412475 1:147444265-147444287 GTGAGGTAGGGGAAGGAGGGAGG + Intergenic
914880991 1:151547118-151547140 GGGAGAGATGGGATGGTGTGAGG - Intronic
914912661 1:151800087-151800109 GTGAGGAAAGTGAAGGTGGGAGG + Intergenic
915029788 1:152868282-152868304 GTGAGGAATGGGAGTGGGGGTGG - Intergenic
915346690 1:155201167-155201189 GCTGGGAATGGGAACGTGTGTGG - Exonic
916041697 1:160966994-160967016 GGCAGGAATGGGGAGGCGTGGGG + Intergenic
916047223 1:161009186-161009208 GTGAGGACTGGGCATGTGGGAGG - Intronic
916058081 1:161081668-161081690 GTGAGGAACAACAAGGTGTGTGG - Intronic
916676131 1:167065738-167065760 GTGAGGGCTGGCCAGGTGTGGGG + Intronic
916714239 1:167435826-167435848 GTCAGGACTAGGAGGGTGTGGGG - Intronic
916822172 1:168410198-168410220 GGGAGGAAGGGGAAGGTAGGTGG + Intergenic
917105303 1:171485736-171485758 GTAAGGAAAGCGAGGGTGTGGGG + Intronic
917265750 1:173218911-173218933 GGTGGGAGTGGGAAGGTGTGAGG - Intergenic
917414815 1:174797665-174797687 GTGGGGTATGGGGAGGTGTGGGG + Intronic
917716698 1:177745589-177745611 GTGAGGAAAGGGAGGGTGGCTGG - Intergenic
918760696 1:188401785-188401807 GTGGGGAAAGGGAGGGTGAGGGG + Intergenic
919364927 1:196647452-196647474 GTGAAGAATAGGAAAGTGTGGGG - Intergenic
919693071 1:200544735-200544757 GTGAGGAAGGGGAGGGAGGGAGG + Intergenic
919732350 1:200921403-200921425 GGGAGGAAGGGCAAGGTTTGGGG + Intergenic
919773358 1:201177127-201177149 CTGAGGAATGGAGAGGGGTGTGG - Intergenic
920007651 1:202845076-202845098 CTGAGGACTGGGGAGGGGTGGGG + Intergenic
920079353 1:203361019-203361041 GTGAGGAGTGGGAGGGAGCGGGG + Intergenic
920103955 1:203537241-203537263 GTGAGGAATGGGATGAGGGGAGG + Intergenic
920153590 1:203929862-203929884 TTGAGTAATGAGAAGCTGTGGGG + Intergenic
920219492 1:204386323-204386345 GTGAGGGATGGGCATGTGTAGGG - Intergenic
920417331 1:205807489-205807511 GTGTGGGATGGGTAGGGGTGTGG + Intronic
920687235 1:208118623-208118645 GTCAGGAATAGAAAGCTGTGAGG - Intronic
921080861 1:211737499-211737521 ATGAGGAATGGGAAGGAGCCAGG - Intergenic
921179652 1:212621990-212622012 TAGAGGAAAGGGAAGGTGGGGGG + Intergenic
921585038 1:216936152-216936174 GTCAGGAATGTGAAGGTTGGGGG + Intronic
1062784894 10:256190-256212 GTGAGGCAGGGGAAGGTGATGGG - Intergenic
1063025310 10:2172663-2172685 GTAAAGAATGGAAAGGTTTGTGG + Intergenic
1063143276 10:3274562-3274584 GTGAGGAATGTGATGGGGTGGGG + Intergenic
1063578582 10:7284306-7284328 GGGAGGAAAGGGAAGGGGTGGGG - Intronic
1063651144 10:7938247-7938269 GCTAGGGATGGGGAGGTGTGTGG + Intronic
1063664623 10:8053900-8053922 GTGAGGGATGAGAAGGGGGGAGG - Intronic
1063768380 10:9169168-9169190 GTGGGGAAAGGGAAAGTGGGAGG + Intergenic
1063960576 10:11302224-11302246 CTGAGGCATGAGAAGGTGAGAGG - Intronic
1063976685 10:11423389-11423411 GTGAGGAATGGGAAGAGAAGGGG - Intergenic
1064405562 10:15059152-15059174 GGGAGGAAAGGGAAGGGGAGAGG - Intronic
1069912038 10:71765710-71765732 GTGAGGGGTGGGGAGGTGTGGGG - Intronic
1070874040 10:79784516-79784538 GTGAGGATCGAGTAGGTGTGTGG - Intergenic
1071119222 10:82258762-82258784 ATGAGGAATGTGAAGGTTGGAGG + Intronic
1071292318 10:84196646-84196668 GAGAGGTATGGGGAGGTGTGGGG + Exonic
1071601371 10:86960141-86960163 GAGAGGACTGGGCAGGTCTGAGG - Intronic
1071631527 10:87222686-87222708 GTGAGCAAGGGAAAGGAGTGCGG + Intergenic
1071640972 10:87306655-87306677 GTGAGGATCGAGTAGGTGTGTGG - Intergenic
1071654264 10:87431281-87431303 GTGAGGATCGAGTAGGTGTGTGG + Intergenic
1072726396 10:97816668-97816690 GTGAGAAATGGGATGGTGGCTGG + Intergenic
1073869986 10:107852339-107852361 GTTAGGAGTTGGAAGGTGAGGGG + Intergenic
1074497408 10:113992199-113992221 GTGAGGAATGTAAAGATTTGGGG + Intergenic
1074554281 10:114474222-114474244 GAGAGAAATGGGAAGCTTTGAGG - Intronic
1074828488 10:117231811-117231833 GTGAGGGATGGGGTGGGGTGGGG + Intergenic
1075711070 10:124530726-124530748 CTGAGGAATGGGCAGGCTTGTGG - Intronic
1076732007 10:132443942-132443964 GAGGGGGAGGGGAAGGTGTGAGG - Intergenic
1076994492 11:291469-291491 GTGGGGACTGGGAAGGCCTGTGG + Intronic
1077111892 11:865615-865637 GTGAGGCGTGGGCAGGTGGGCGG + Intronic
1077184621 11:1230636-1230658 AAGAGGCATGCGAAGGTGTGTGG + Intronic
1077186454 11:1237475-1237497 CTGAGGACTGGGCAGGTCTGGGG - Intronic
1077738509 11:4818007-4818029 GGGAGGAATGGGAAGTGGAGAGG + Intronic
1078100537 11:8327936-8327958 GTGGGGAAAGGGAAGGGGAGTGG + Intergenic
1078145806 11:8721259-8721281 GGGAGGAGTGGGAGGTTGTGGGG - Intronic
1078603021 11:12749911-12749933 TTGAGGATTGGGATGGGGTGCGG + Intronic
1078869173 11:15327977-15327999 GTGGGGAATGAGCAGGAGTGGGG + Intergenic
1079141121 11:17810323-17810345 TTGCGGGATGGGGAGGTGTGAGG - Intronic
1079201951 11:18384051-18384073 GTGAGGCAGGGGCAGGTGTCAGG + Intergenic
1079648362 11:22895436-22895458 GTGAGGAAGGTCAAGGGGTGAGG - Intergenic
1079903977 11:26222530-26222552 GTGAGGAGAGGGAAAATGTGGGG - Intergenic
1079940467 11:26674027-26674049 GTGAGGCATGAGGAGGTGTGAGG - Intronic
1080903281 11:36515664-36515686 AAGAGGGAAGGGAAGGTGTGTGG + Intronic
1080984879 11:37450470-37450492 GGGTGGAGTGGGGAGGTGTGGGG + Intergenic
1081123042 11:39289815-39289837 TTGAAGAAAGGGAATGTGTGGGG - Intergenic
1081403491 11:42669331-42669353 GAGAGGAATGGAGAAGTGTGAGG + Intergenic
1081930197 11:46864595-46864617 GTGAGGAATGGAAAGCTGAAAGG + Intronic
1082740629 11:56907103-56907125 CTGTGGAAAGGGAAGGTGGGCGG + Intergenic
1083050167 11:59769864-59769886 GTGTGGGGGGGGAAGGTGTGTGG + Intronic
1083518928 11:63288428-63288450 GTGAGGGGTGGGAAGAAGTGGGG + Intronic
1084317343 11:68353284-68353306 TGGAGCAAAGGGAAGGTGTGGGG - Intronic
1084596267 11:70118761-70118783 TTGATGGATGGGTAGGTGTGTGG + Intronic
1084715122 11:70868810-70868832 GTGAGAATTGGGCAGGTTTGTGG - Intronic
1085207366 11:74744051-74744073 GTGAGGAAGGGGTAGTGGTGGGG + Intergenic
1085753767 11:79187051-79187073 GGGAGGAATGGGAAGGGGTTGGG - Intronic
1085759377 11:79228518-79228540 GTGAGGTCTGAGAAGGTGGGTGG - Intronic
1087044807 11:93836072-93836094 ATGAGGAAGGAGAAGGTGTCAGG - Intronic
1087586033 11:100122596-100122618 GTGAGCAATGTGAATGTCTGGGG + Intronic
1089110746 11:116053983-116054005 GTGGGCAATGGGGAGGTATGAGG + Intergenic
1089271094 11:117301752-117301774 GTGAAGAAGAGGAAGGTGTTAGG - Intronic
1089781910 11:120879189-120879211 GTGAGGAATAGCCAGGAGTGGGG - Intronic
1090433722 11:126668460-126668482 GTGGGGAAAGGGAAGCTGTCTGG - Intronic
1090867428 11:130714015-130714037 GTGAGGAAATGGAATGTGAGAGG - Intronic
1091393747 12:141311-141333 GTGGGGTGTGGGAAGGAGTGGGG - Intronic
1091446223 12:545650-545672 GTGAGGAGTGGGGAGGAGCGAGG + Intronic
1091446238 12:545701-545723 GTGAGGAATGGGGAGGAGCGAGG + Intronic
1091446248 12:545735-545757 GCGAGGAGTGGGGAGGAGTGAGG + Intronic
1091446253 12:545752-545774 GTGAGGAGTGGGGAGGTGAGAGG + Intronic
1091446278 12:545835-545857 GTGAGGAGTGGGGAGGAGCGAGG + Intronic
1091446283 12:545852-545874 GCGAGGAGTGGGGAGGTGAGAGG + Intronic
1091446288 12:545869-545891 GAGAGGAGTGGGGAGGTGCGAGG + Intronic
1091446298 12:545901-545923 GTGAGGAGTGGGGAGGTGCGAGG + Intronic
1091446303 12:545918-545940 GCGAGGAGTGGGGAGGTGAGAGG + Intronic
1091446308 12:545935-545957 GAGAGGAGTGGGGAGGTGCGAGG + Intronic
1091446313 12:545952-545974 GCGAGGAGTGGGGAGGTGAGAGG + Intronic
1091446322 12:545986-546008 GAGAGGAGTGGGGAGGTGAGAGG + Intronic
1091446331 12:546020-546042 GTGAGGAATGGGGAGGAGTGAGG + Intronic
1091446404 12:546254-546276 GTAAGGAGTGGGGAGGTGGGAGG + Intronic
1091728837 12:2864922-2864944 GTGATGAGTGGGCAGGTGGGTGG + Intronic
1092122442 12:6053946-6053968 TAGAGGACAGGGAAGGTGTGGGG + Intronic
1092394089 12:8109828-8109850 GTGTGTAATGGGATGGTGTAAGG + Intergenic
1093898698 12:24605381-24605403 GTGAGGCATGGGAAGTTATAAGG - Intergenic
1096503811 12:52080818-52080840 CTGGGGAATGGGGAGGTGTGTGG + Intergenic
1096657244 12:53099251-53099273 CTCAGGACTGGGAAGGGGTGAGG - Intronic
1096774256 12:53954767-53954789 GTGCGGGATGGGATGGTGGGGGG + Intergenic
1097183434 12:57183910-57183932 GTGAGCAGTGGGCAGGTTTGTGG + Intronic
1097195991 12:57242755-57242777 GCGAGGAGCAGGAAGGTGTGGGG - Intergenic
1097456220 12:59801938-59801960 GTGGGTAGTGGGAAGGTGAGCGG + Intergenic
1098484472 12:71004702-71004724 GAGAGAATTGGGCAGGTGTGTGG - Intergenic
1098791800 12:74833574-74833596 CTGAGGAATGGGGGGGTGGGAGG + Intergenic
1099775527 12:87123186-87123208 GTGAGAAATGGGAGGGTATGTGG - Intergenic
1100226679 12:92563995-92564017 GTGAGCAGTGGGATGGAGTGAGG + Intergenic
1100240806 12:92708888-92708910 GTAAGGAATGGGGAAGAGTGGGG + Intergenic
1101063979 12:101000194-101000216 GTGTGTAATGGGAAAGTTTGAGG + Intronic
1101317351 12:103641804-103641826 TTGAGGTGTGGGAAGGTTTGTGG - Intronic
1101811048 12:108108066-108108088 GAGAGGAGAGGGAGGGTGTGGGG + Intergenic
1102582181 12:113896659-113896681 GTGAGGAGAGGGAAGGCGGGAGG + Intronic
1102623618 12:114216788-114216810 ATGAGGAATGGAAAGGAGGGAGG + Intergenic
1102717399 12:114986273-114986295 GGGAGGAAGGGAAAGGGGTGGGG - Intergenic
1103024442 12:117562257-117562279 ATGAGGAAGGGGAGGGGGTGGGG + Intronic
1103239056 12:119398087-119398109 GGGAGGAAGGGGGCGGTGTGGGG + Intronic
1104147257 12:126047087-126047109 GGGAAGAATGGGAGGGAGTGAGG + Intergenic
1104179852 12:126368743-126368765 CTGAGCAGTGAGAAGGTGTGAGG + Intergenic
1104289201 12:127453529-127453551 GTATAGAATGGGGAGGTGTGAGG + Intergenic
1104586437 12:130051779-130051801 GTGTGGAAGGAGATGGTGTGTGG - Intergenic
1104831743 12:131757251-131757273 GAGAGGAACGGGAAGCTCTGAGG + Intronic
1104962541 12:132495118-132495140 GTGGGGAATGTGAGGGTGTGAGG + Intronic
1105007300 12:132729450-132729472 GAGGGGAATGGGAGGGTGGGAGG + Intronic
1105046409 12:133007541-133007563 GTGAGAAAGAGGAAGGTGGGAGG + Intronic
1105202660 13:18193426-18193448 GGCAGGAATGGGAAGGTCTAGGG + Intergenic
1105303758 13:19155501-19155523 GTCAGGGATGGGAAGGGCTGTGG + Intergenic
1106647437 13:31651480-31651502 GTGAGGCAAGGCAAGGTGTGAGG - Intergenic
1106684964 13:32049029-32049051 TTGATGAAAGGGAAGGTGTAAGG + Intronic
1107384767 13:39896065-39896087 GGAAGGAATGTGAAGGTGTAAGG + Intergenic
1107430282 13:40334248-40334270 GGCAGGGATGGGAGGGTGTGGGG + Intergenic
1108461664 13:50673225-50673247 AAGAGGAATGGGAAGGTTGGGGG - Intronic
1108506178 13:51114371-51114393 GGGAGGAATGAGAAGATGTAGGG - Intergenic
1108589586 13:51901429-51901451 GTGAGGCATGGGAGGGCGGGTGG - Intergenic
1109493353 13:63132813-63132835 GTGAGGCCTGGGACTGTGTGGGG - Intergenic
1111209721 13:85062109-85062131 GTAAGGTATGGGAAGGGGTGGGG + Intergenic
1111359245 13:87153001-87153023 GTGGGGAATGGGAAGGGGGGAGG + Intergenic
1111989396 13:95102041-95102063 GTGAGGAAAGAGAAGGTAAGCGG + Intronic
1112986656 13:105458273-105458295 GTGAGGAAGGGGGAGCTGGGGGG - Intergenic
1113181488 13:107632920-107632942 AAAAGGAATGGCAAGGTGTGTGG + Intronic
1113483798 13:110640384-110640406 GAGAGCAACGGGAAAGTGTGGGG + Intergenic
1113804740 13:113106446-113106468 GTGAGGTGTGGGAAAGTGTGTGG + Intronic
1113860845 13:113485593-113485615 GTGAGGAATTGGTATGTGTGAGG - Intronic
1113871972 13:113565158-113565180 GAGAGGAAGGGGAGGGTCTGAGG - Intergenic
1113872015 13:113565346-113565368 GAGAGGAAGGGGAGGGTCTGAGG - Intergenic
1114529445 14:23386617-23386639 GGGAGGCCTGGGAAGGGGTGGGG + Exonic
1115199836 14:30841091-30841113 GTGAGCAACGGGAAGGTTGGTGG - Intergenic
1115205531 14:30899697-30899719 CTTAGGAATGGAAAGGTGTTTGG - Intronic
1115479357 14:33846132-33846154 GTGAGGAATGGGGGGGAGTTGGG - Intergenic
1115728575 14:36243499-36243521 GAGAGGGATGGGAAAGTTTGGGG + Intergenic
1115770307 14:36659748-36659770 GTGAGAACTGGGAAGATGTGTGG + Intronic
1115786935 14:36837105-36837127 CAGAGTGATGGGAAGGTGTGTGG + Intronic
1116627114 14:47279741-47279763 TAGGGGAATGGGTAGGTGTGTGG - Intronic
1116764432 14:49053010-49053032 GTGAGGTATTGGAAGCTGTATGG - Intergenic
1117166565 14:53040097-53040119 TGGGGGAATGGGAAGGTGAGTGG + Intronic
1117405005 14:55393483-55393505 CTGAGAAATGGGAAGGAGTCAGG - Intronic
1117732365 14:58736311-58736333 TGGATGAATGGGAAGGTGAGAGG - Intergenic
1117848882 14:59946648-59946670 GTGAGGAGTGGGGAGGGGGGAGG - Intronic
1118201507 14:63678362-63678384 GTGAGGGCTTGGAAGGTGAGGGG + Intergenic
1118769363 14:68931552-68931574 GTGAGGAATGGTGAGGAATGTGG + Intronic
1118868033 14:69718520-69718542 TTGGGGAAAGGGAAGCTGTGTGG - Intergenic
1119070609 14:71579463-71579485 GAGAGGAATGAGCATGTGTGAGG + Intronic
1119257585 14:73211823-73211845 GTGAGGAATGGGAAGCCCAGAGG + Exonic
1119507896 14:75188622-75188644 GGGAGGAATGGGAAGCTAGGAGG + Intergenic
1119762464 14:77161203-77161225 GGCAGGAATGGGAAGGAGAGTGG - Intronic
1120597314 14:86457133-86457155 GTTAAGAATGGGAAAGAGTGAGG - Intergenic
1120758106 14:88263014-88263036 GTGAGGCATGTGACAGTGTGGGG - Intronic
1120899509 14:89563677-89563699 GTATGGAAGGGGCAGGTGTGAGG + Intronic
1121005009 14:90484511-90484533 GGTAGGAATGGGAAGGTGGATGG - Intergenic
1121566563 14:94914508-94914530 GGGATGGATGGGCAGGTGTGTGG - Intergenic
1122581224 14:102772980-102773002 GTGATGACAGGGAAGGTGAGAGG - Intergenic
1122713207 14:103676092-103676114 GTGAGGAAAAGGAGTGTGTGTGG - Intronic
1123055545 14:105567649-105567671 GTGTGGTATGGACAGGTGTGTGG + Intergenic
1123055593 14:105567849-105567871 GTGTGGTGTGGGCAGGTGTGTGG + Intergenic
1123106609 14:105844771-105844793 CTGAGGAATGAGCAGGTGGGTGG + Intergenic
1123133673 14:106008121-106008143 GTGTGCAATGAGAGGGTGTGGGG + Intergenic
1123507474 15:20958745-20958767 ATGAGGAATGGGGAGATTTGTGG + Intergenic
1123564700 15:21532486-21532508 ATGAGGAATGGGGAGATTTGTGG + Intergenic
1123600956 15:21969777-21969799 ATGAGGAATGGGGAGATTTGTGG + Intergenic
1124106167 15:26740137-26740159 GTGAGGATGGGGATGGTGGGGGG - Intronic
1124139853 15:27067628-27067650 GTCAGGAAAGGGAAGGGGAGTGG - Intronic
1125788837 15:42347210-42347232 GTGAGGAAGGGGCATGTGTGGGG + Intronic
1126845192 15:52753213-52753235 GTTAGGAAGGGGGAGGGGTGGGG + Intergenic
1127046821 15:55034718-55034740 GTGGGGAATGGGACGGTGTGGGG - Intergenic
1127328984 15:57920627-57920649 GTAAAGAATGAGCAGGTGTGAGG + Intergenic
1127454288 15:59143340-59143362 GGGAGGAGTGGGCAGGTGGGTGG + Intronic
1128619103 15:69133754-69133776 CTGAGGACAGGGAAGGAGTGTGG + Intergenic
1129039906 15:72676800-72676822 GTTAGGAATGGGGAGGTGGTGGG + Intronic
1129170888 15:73807202-73807224 GTGAGGGAGGGGAAGGGGAGAGG + Intergenic
1129237205 15:74230824-74230846 ATGAGGAATGGGAGGCTCTGAGG + Intergenic
1129366450 15:75058530-75058552 GTGGGGAGTGGGTGGGTGTGAGG + Intronic
1129430561 15:75498379-75498401 GTTAGGAATGGGGAGGTGGTGGG + Intronic
1131270979 15:90947529-90947551 GTGTGGCCTGGGAAGGGGTGGGG + Intronic
1131539749 15:93266357-93266379 GTGAGGAAGGGGATGCAGTGGGG - Intergenic
1131556720 15:93405964-93405986 GTGACAAATGAGCAGGTGTGAGG + Intergenic
1131621438 15:94072295-94072317 ATGAGGAAGTGGAAGGTGTTGGG - Intergenic
1131714592 15:95094778-95094800 GTGGGGAATGGGAGGTTGGGAGG - Intergenic
1131875461 15:96801594-96801616 GAGAGGAATAGGGAGGTGTGGGG - Intergenic
1202973064 15_KI270727v1_random:259597-259619 ATGAGGAATGGGGAGATTTGTGG + Intergenic
1132606813 16:797093-797115 GTGTGGAATGGGCAGCTGTGGGG + Intronic
1133381596 16:5335660-5335682 GTGTGGAGTGGCACGGTGTGGGG + Intergenic
1134072881 16:11271782-11271804 GGGAGGACTGGAAAGGTGTGTGG - Intronic
1134136792 16:11681825-11681847 GGGAGGAAGAGGAAGGGGTGGGG - Intronic
1134596575 16:15500527-15500549 TTGAGGAAGGGGAAGGTATCAGG + Intronic
1134866029 16:17607933-17607955 GAGAGGAATGGGAAGATTGGGGG - Intergenic
1136052197 16:27659766-27659788 CTGAGGAATGGGAGGGAGTGTGG + Intronic
1136230199 16:28881145-28881167 GTCTGGAATGGGATGGAGTGTGG + Intronic
1136295476 16:29299093-29299115 TGGATGAATGGGTAGGTGTGTGG + Intergenic
1136381330 16:29897249-29897271 GTGGGGAAGGGAAAGGTGGGGGG - Intronic
1136468348 16:30460676-30460698 GAGAGGAAGGGGAAGGGGAGGGG + Intergenic
1138190450 16:55009748-55009770 ATGTGGATTGGGAAGGTCTGGGG + Intergenic
1138550479 16:57745101-57745123 ATGGAGAATGGGAAGGAGTGGGG - Intronic
1139319976 16:66106517-66106539 GAGAGGAATGGGGAGGTGAGAGG + Intergenic
1139573688 16:67828451-67828473 GTGAGAAGGCGGAAGGTGTGGGG - Intronic
1139925354 16:70482982-70483004 GAGAGGAGAGGGAAGGGGTGGGG - Intronic
1139925371 16:70483026-70483048 GAGAGGAGAGGGAAGGGGTGGGG - Intronic
1140208028 16:72949361-72949383 GCGAGGGAGTGGAAGGTGTGTGG + Intronic
1140917824 16:79509558-79509580 GCCAGGAATGGGAAGGCGGGTGG - Intergenic
1141251648 16:82364088-82364110 GTGTGGAGTGGGAGGGTGGGGGG + Intergenic
1141498250 16:84425199-84425221 GTAGGGACTGGGAAGGTGGGTGG - Intronic
1141748855 16:85944996-85945018 GTGATGAATGGGTAGATGAGTGG - Intergenic
1141908558 16:87043154-87043176 GTGAGGAATGGTGTGGTTTGGGG - Intergenic
1142284779 16:89167315-89167337 CTGAGCACTGGGAAGGTGGGGGG - Intergenic
1142432258 16:90035903-90035925 GCTAGGAGTGGGAATGTGTGTGG - Intronic
1142656632 17:1399267-1399289 CTGAGGAAAGGGAGGGAGTGAGG + Intronic
1142991062 17:3731279-3731301 GTGAGGAATGTGAAAATCTGAGG - Intronic
1143319936 17:6061618-6061640 GTGGGGAATGGACAGGTGGGTGG + Intronic
1143582784 17:7836239-7836261 GTTAGGAATGGGAAGGGTTTTGG - Intergenic
1143755509 17:9064421-9064443 GTGAGAAATGGGGAGCTGTGGGG - Intronic
1143813008 17:9487713-9487735 ATGAGGACAGGGGAGGTGTGGGG + Intronic
1144625152 17:16840672-16840694 GGGTGAAATGGGAAGGAGTGAGG - Intergenic
1144881277 17:18432049-18432071 GGGTGAAATGGGAAGGAGTGAGG + Intergenic
1145150955 17:20512337-20512359 GGGTGAAATGGGAAGGAGTGAGG - Intergenic
1145743369 17:27294436-27294458 GTGAGGATTGGGACCGTGGGTGG + Intronic
1145911573 17:28546382-28546404 GGGTGCAAGGGGAAGGTGTGGGG - Intronic
1146455220 17:33004425-33004447 AAGAGAAAGGGGAAGGTGTGAGG + Intergenic
1146532747 17:33623880-33623902 GTGACAGATGGGAAGGTGGGGGG - Intronic
1147168471 17:38605339-38605361 GTGTGGAAGGGGGAGGGGTGAGG - Intronic
1147579305 17:41619371-41619393 GGGTGAAATGGGAAGGAGTGAGG - Intergenic
1147588885 17:41668488-41668510 GTGAGGAATGTGAAGCCCTGCGG + Intergenic
1147846011 17:43404266-43404288 GAGAGGAAAGGGAGGGAGTGAGG + Intergenic
1148135047 17:45286771-45286793 GGGTGGAATGGGAAGGGATGAGG + Exonic
1148767819 17:50049500-50049522 GTGAAGAATTAGAAGGGGTGAGG + Intergenic
1148998053 17:51729174-51729196 TTGAGGAATAGCAAGGTGTAGGG - Intronic
1149695866 17:58615617-58615639 GTGGGGAATGGGTAGGGGAGGGG + Intronic
1150293197 17:63993357-63993379 GGGAGGGAAGGGAAGGTGGGAGG + Intergenic
1150293213 17:63993395-63993417 GGGAGGGAAGGGAAGGTGGGAGG + Intergenic
1151452987 17:74210783-74210805 GTAAGGATTGTGAGGGTGTGAGG + Intergenic
1151831126 17:76551895-76551917 CTGTGAAATGGGAAGGTGGGGGG + Intronic
1152613826 17:81328920-81328942 GAGAGGCGTGGGCAGGTGTGGGG + Intronic
1152755391 17:82084998-82085020 GTGGGGAAGGGGAAGTGGTGAGG + Intronic
1152797176 17:82314206-82314228 GTGAGTGAGGGGCAGGTGTGAGG + Intergenic
1153019565 18:614574-614596 GTGAGAAATGGGAGGGTGAGAGG - Intronic
1153749303 18:8212249-8212271 GTGAGGAATGGGCAGGTCCAAGG + Intronic
1153985650 18:10348634-10348656 GTGAGGAGTGGGAAGGGGAGGGG + Intergenic
1154080107 18:11248067-11248089 GTGAGGAGAGGGAGTGTGTGTGG - Intergenic
1154131850 18:11743885-11743907 GTGAGGCAAGGGTAGGTGTGGGG - Intronic
1155543674 18:26891887-26891909 ATGAGGACTGGGGAGATGTGTGG - Intergenic
1156267179 18:35499420-35499442 GTGAGGAATGGGAGGAGGTGGGG - Intergenic
1156381606 18:36566805-36566827 ATGAGGAAAGGGAAGGAGTCTGG + Intronic
1156490334 18:37492196-37492218 GTGGGGAATGGGAAGGTAGCAGG + Intronic
1157089999 18:44625855-44625877 GTGAAGAAGGGGAAGCTGTGAGG + Intergenic
1157186079 18:45540963-45540985 GTGATGAGAGGGAAGGGGTGAGG + Intronic
1160123631 18:76151451-76151473 ATGGGGAAAGGGAAGGTGTGAGG - Intergenic
1160531977 18:79571163-79571185 GGGAAGAATTGGAAGGTGTTGGG - Intergenic
1160557715 18:79736729-79736751 GTGAGGTGTGTGCAGGTGTGGGG + Intronic
1161151666 19:2713282-2713304 GTGAGGAATGGGATGAAGGGTGG - Intergenic
1161151755 19:2713634-2713656 GTGAGGAATGGGATGAAGGGTGG - Intergenic
1161151829 19:2713898-2713920 GTGAGGAATGGGATGAAGGGTGG - Intergenic
1161151841 19:2713942-2713964 GTGAGGAATGGGATGAAGGGTGG - Intergenic
1161411644 19:4121355-4121377 GTGAGGAACGAGGAGGCGTGGGG - Intronic
1161496735 19:4590701-4590723 GTGAGGAATGGGAGGAAGGGAGG + Intergenic
1161754648 19:6123114-6123136 GTGAGGAATGAGAAGGAAAGAGG + Intronic
1162432828 19:10639421-10639443 GTGGGGGCTGGGCAGGTGTGGGG + Intronic
1162526585 19:11209981-11210003 GTGAGGGATGGGCAGGTGAGAGG - Intronic
1162859640 19:13496407-13496429 TAGAGGAAGGGGAAGCTGTGGGG + Intronic
1162902846 19:13805555-13805577 GTGAGGGCTGGGAGGGTTTGGGG + Intronic
1163351183 19:16777493-16777515 GGGAGGAAAGGGAAGGGGAGGGG + Intronic
1163492724 19:17626376-17626398 ATGAGGGATGGGTAGGTGGGTGG - Intronic
1164672660 19:30081732-30081754 GTGAGGAAGAGGAAAGTGTTGGG + Intergenic
1164889036 19:31807340-31807362 GTGAGGAATGGGAGCGGGAGAGG - Intergenic
1165432486 19:35780678-35780700 GGGAGGGGTGGGAAGGGGTGGGG + Intronic
1165726294 19:38115313-38115335 GCAGGGAATGGGAAGGTGGGAGG - Intronic
1165763505 19:38336236-38336258 GCGTGGAAGGAGAAGGTGTGGGG + Intronic
1165864714 19:38929794-38929816 GAGAGGAATGGGAAGACGTGGGG + Intronic
1166343767 19:42152927-42152949 ATGAGGCAGGGGAAGGTCTGGGG + Intronic
1166881876 19:45934857-45934879 GTGGGGCATGGGATGGGGTGCGG + Exonic
1166994951 19:46715933-46715955 GAGAGGACTGGGCAGGGGTGGGG - Intronic
1167156496 19:47742250-47742272 GACAGGAAAGGGAAGGGGTGTGG - Exonic
1167557788 19:50206395-50206417 GTGAGGAAGTGGATGGGGTGGGG + Intronic
1167590887 19:50403598-50403620 GTGAGGGCTGGGCAGGTGGGAGG + Intronic
1167776878 19:51564296-51564318 GTGAGGGCTGGGAAGGAGAGAGG + Intergenic
1168049917 19:53821747-53821769 GCGAGGAATCAGAAGGAGTGGGG + Intronic
1168178891 19:54646074-54646096 GGGAGCAATGGGAGGGGGTGAGG + Intronic
1168252458 19:55148321-55148343 GTGATGTATGGGAAGGTGAAAGG - Intronic
1168439840 19:56354719-56354741 GAGCTGAATGGGAAGGTGGGAGG - Intronic
1202669974 1_KI270709v1_random:40934-40956 GTGAGGAAACCGAAGGTCTGAGG + Intergenic
925317010 2:2934273-2934295 GGGAGGAAGGGGAGGGGGTGAGG - Intergenic
925542857 2:4985188-4985210 GTGGGGAGTGGGAAGGAGAGGGG + Intergenic
926253282 2:11168568-11168590 GTGCGGAATGGGAAGAGCTGGGG - Intronic
926380824 2:12287583-12287605 TAGAGGACTGGGAAGGTGTCTGG + Intergenic
926877772 2:17502609-17502631 GATAGGAATGGGAAGGAATGTGG + Intergenic
927429908 2:23018798-23018820 GAGAGGAGTGGGAAGGACTGAGG + Intergenic
927680304 2:25134631-25134653 GGGAGGGAAGGGAAGGTGTGAGG - Intronic
927871616 2:26627754-26627776 GTGAGGGGTGGGTAGGTGGGTGG - Intronic
928062525 2:28129106-28129128 TAGAGGAGTGGGTAGGTGTGTGG + Intronic
928072150 2:28227706-28227728 GGCTGGAATGGGAAGGGGTGTGG - Intronic
928214861 2:29352746-29352768 GTGAGGAATAAGAGGGTTTGTGG + Intronic
928392353 2:30919355-30919377 GTGAGGAATGGATAGGACTGGGG + Intronic
928486177 2:31734747-31734769 GTGAGGATTCTGAAGGTCTGAGG - Intergenic
929575754 2:43050591-43050613 GGGAGGAACGGGAAGGGGTGCGG + Intergenic
929765684 2:44842379-44842401 GGGAGGAATGGGATGGGGAGAGG + Intergenic
930607160 2:53504612-53504634 GTGAGGAATGGGAGGGAGGCAGG + Intergenic
931143059 2:59484891-59484913 GAGAGAAATGGGGAGATGTGGGG + Intergenic
931881409 2:66574970-66574992 GTGGGGAAGGGGAAGGGGTGGGG - Intergenic
934902488 2:98171818-98171840 GTGATAAATGGGCAGGTATGAGG + Intronic
935308425 2:101759689-101759711 GAGAGGAATGGGGAGGGGAGGGG - Intronic
935562774 2:104575938-104575960 TAGGGGAATGGGAAGGTGAGAGG - Intergenic
935634921 2:105242876-105242898 GGGAGGATTTGGAAGGTCTGGGG - Exonic
936469799 2:112788933-112788955 GAGAGGAGGGGGAAGGAGTGAGG + Intergenic
936525395 2:113237760-113237782 GTGACGAGTGTGAAGGTATGTGG - Intronic
936870999 2:117134074-117134096 GAGGGGAATGGGAAGCTGTTTGG - Intergenic
937118685 2:119427323-119427345 TTGAGGAGTTGGAAGGTGGGAGG - Intergenic
937886353 2:126902175-126902197 GAGAGGAGTGGGAGGGTGAGGGG - Intergenic
939587077 2:144019056-144019078 GAGATAGATGGGAAGGTGTGGGG + Intronic
939655464 2:144818880-144818902 GCAAGGAATGGGAAAGTCTGTGG + Intergenic
939806956 2:146785615-146785637 GTGAGCAATGGGAAAGACTGAGG - Intergenic
940898157 2:159101129-159101151 GAGAGGAATTGGCAGGGGTGGGG - Intronic
940969892 2:159884417-159884439 TTGAGGAGTGGAAGGGTGTGAGG - Intronic
941415915 2:165221323-165221345 GTGAGGAAAGGAAAGGAGTGAGG - Intergenic
941590340 2:167412040-167412062 GTCAGGAAGGGTAGGGTGTGGGG + Intergenic
942893328 2:181018683-181018705 TGGAGGACTGGGAAAGTGTGAGG - Intronic
944481894 2:200165715-200165737 GTGAGAAAGGGGAAGGTTTGAGG - Intergenic
945048265 2:205800609-205800631 GTGAGGAATGGGTGGTAGTGGGG - Intergenic
946010933 2:216563010-216563032 GGCAGGAATGAGACGGTGTGAGG + Intronic
947232674 2:227903647-227903669 GGGAGGAAGGGGAGGGTGGGAGG - Intronic
947232682 2:227903664-227903686 GGGAGGAAGGGGAGGGTGGGAGG - Intronic
947232690 2:227903681-227903703 GGGAGGAAGGGGAGGGTGGGAGG - Intronic
947293437 2:228603280-228603302 GTGAGCATTGGGAAGTTGGGGGG + Intergenic
947796586 2:232897080-232897102 GTGAGGGTTGGGATGGGGTGGGG + Intronic
948284622 2:236773987-236774009 GTGGGGAATGGGATGCTGTGGGG + Intergenic
948477633 2:238230730-238230752 GAGAGGAATGGCAAGGTTTGAGG + Intronic
948621468 2:239237714-239237736 GTTAGAACTGGGAAAGTGTGAGG + Intronic
948659393 2:239497823-239497845 GTGTGGAAACGGAGGGTGTGGGG - Intergenic
948667486 2:239545664-239545686 CTGAGGGAGGGGAAAGTGTGAGG - Intergenic
948684126 2:239659444-239659466 CAGAGGAAGGGGAAGGTGTGAGG - Intergenic
948706781 2:239799259-239799281 ATGAGGAAAGGGGAAGTGTGAGG + Intronic
948899948 2:240951159-240951181 TGGATGAATGGGTAGGTGTGTGG - Intronic
1168948461 20:1780575-1780597 GTGGAGAATGGGAAGGAGCGTGG + Intergenic
1169022617 20:2340840-2340862 GTGAGGAATGAGCAGGGCTGTGG - Exonic
1169854099 20:10084656-10084678 GTGACGTATGGGAAAGAGTGAGG + Intergenic
1170296535 20:14832378-14832400 GAGAGGGATGGGAAGGAGGGAGG + Intronic
1170795964 20:19546861-19546883 GGGTGGAAAGGGAAGGCGTGGGG - Intronic
1170829264 20:19825454-19825476 GAGAGGACTGGGAAGGGGAGAGG - Intergenic
1170930568 20:20766602-20766624 GTGAGCACTGGGTAGGTGGGTGG + Intergenic
1171215631 20:23350463-23350485 GAGAGGGAGGGGAAGGTGTGTGG - Intergenic
1172068489 20:32238879-32238901 GTGAGGAATGCGGAGGTGAAGGG - Intergenic
1172649377 20:36492134-36492156 GTGAGGTATTGGAAGAGGTGGGG + Intronic
1173176775 20:40770902-40770924 GTGAGGGAAGGGAAGGGCTGTGG - Intergenic
1173192573 20:40887534-40887556 GAGAGGAAGGGGCAGGGGTGGGG - Intergenic
1173657721 20:44711873-44711895 GGGAGAAATGAGGAGGTGTGAGG - Intergenic
1174107321 20:48171976-48171998 GTCAGGACTGGGCAGGGGTGGGG - Intergenic
1174260055 20:49287427-49287449 ATTAGGAGTGGGAAGGTATGAGG + Intergenic
1174481456 20:50834057-50834079 GTCAGGAATGAGACGGAGTGAGG + Intronic
1174863502 20:54114294-54114316 GTGAGGAATGGGCTGGAGTAGGG + Intergenic
1174863529 20:54114396-54114418 GTGAGGAGTGGGCAGGAGTGGGG + Intergenic
1174863539 20:54114430-54114452 GTGAGGAGTGGGCAGGAGTGGGG + Intergenic
1174875292 20:54221010-54221032 GTGGGGAATGGATAGGTCTGGGG + Intronic
1175017015 20:55802293-55802315 AAGAGGTATGGGAAGCTGTGTGG + Intergenic
1175415250 20:58796725-58796747 GTGTGGAAGGGGCAGGTGTCTGG - Intergenic
1175499890 20:59442188-59442210 GGGAGGGAAGGGAAGGAGTGGGG - Intergenic
1175648875 20:60699282-60699304 GAGAGGGATGGGAAGATGTCAGG + Intergenic
1175980421 20:62735890-62735912 GTGAGGAATTGGAGGGTAAGGGG - Intronic
1176715292 21:10344583-10344605 GGCAGGAATGGGAAGGTCTAGGG - Intergenic
1176938557 21:14896296-14896318 CTGAGTACAGGGAAGGTGTGAGG - Intergenic
1178359378 21:31935314-31935336 GTGAGTAGGGGGAAGGTATGCGG - Intronic
1178603990 21:34019168-34019190 GTGAGGACAGGCCAGGTGTGTGG - Intergenic
1178997089 21:37412643-37412665 GAGAGGAATGGAAAGGCATGAGG + Intronic
1179451987 21:41473931-41473953 GTGAGGAGTGAGGAGGTGAGGGG + Intronic
1180186112 21:46140162-46140184 GTGAGCAATGTGAAGGTGGACGG - Intronic
1180228652 21:46413235-46413257 GTGGGGAGGGGGAAGGCGTGAGG + Intronic
1180603056 22:17035371-17035393 GGCAGGAATGGGAAGGTCTAGGG + Intergenic
1181560668 22:23697762-23697784 GTGCAGCATGGGAAGGGGTGGGG + Intronic
1181669437 22:24419290-24419312 GTGAGGCAGGGGGAGGGGTGCGG + Intronic
1182047939 22:27290432-27290454 GTGAAGAGTAGGAAGGGGTGAGG - Intergenic
1182326913 22:29520172-29520194 GTGGGGCATGGGAGGGTGGGAGG - Intronic
1183228007 22:36563482-36563504 TTGAGGAAAGGGAAGGAGAGGGG - Intergenic
1183339822 22:37274029-37274051 GGGAGGAAGTGGAGGGTGTGAGG - Intergenic
1183341969 22:37286537-37286559 GTGGGGAATGGGAAGGGGTGGGG + Intronic
1183512843 22:38245912-38245934 GTGAGGATGGGGACGGAGTGGGG - Intronic
1184241193 22:43212107-43212129 GTGAGGAGGGGGCAGGAGTGTGG - Intronic
1184259159 22:43304845-43304867 GTGTGCAAAGGGATGGTGTGGGG - Intronic
1184420777 22:44381765-44381787 GGGAGGAAGGGGAAGGGGAGGGG + Intergenic
1184533018 22:45068969-45068991 GGGATGAGTGGGAAGGAGTGAGG - Intergenic
1184703475 22:46193979-46194001 GTGGGTAATAGGAAGGGGTGGGG + Intronic
1184807729 22:46806388-46806410 TTGAGTAATGGGATGGTTTGTGG - Intronic
1185046193 22:48529772-48529794 GTGTGGACGGGGAGGGTGTGTGG + Intronic
1203300217 22_KI270736v1_random:71949-71971 GTAAGGAATGGAATGGAGTGTGG + Intergenic
949814761 3:8046768-8046790 GGGAAGAGTGGGAAGGTTTGAGG + Intergenic
950182229 3:10922595-10922617 GGGAGGAATGGGAATGAGGGAGG + Intronic
950366400 3:12488149-12488171 CTGAGGGAGGGGAAGGTGAGTGG - Intronic
951519749 3:23600247-23600269 CAGAGTAATGGGAAGGTGTAAGG - Intergenic
951622356 3:24617000-24617022 GTGAGGAAAGGGAAGGAATCAGG + Intergenic
951718051 3:25670121-25670143 GTGAGAAACAGGATGGTGTGAGG + Intergenic
953294510 3:41700440-41700462 GTCAGGAGTGTGAATGTGTGTGG - Intronic
953341237 3:42135649-42135671 GTGTGGAATTGGACTGTGTGTGG + Intronic
953489414 3:43336233-43336255 GGGAGGAAAGGGAAGGAGAGAGG - Intronic
953922374 3:46960994-46961016 GCAGGGAATGGGAGGGTGTGGGG + Intronic
954412632 3:50377709-50377731 GTGAGGAAAGGGGAGGGTTGGGG - Intronic
954421347 3:50420617-50420639 GTGGAGAGTGGGAGGGTGTGGGG + Intronic
954713520 3:52516239-52516261 GTGAGGACTGGGGAGGGGCGGGG + Intronic
954774898 3:53008137-53008159 ATGGGGAATGGGGGGGTGTGAGG + Intronic
954824069 3:53355803-53355825 GAGAGGAAAGGGAAAGAGTGGGG - Intergenic
954903730 3:54042103-54042125 GTGAGGAATGGAAGGAGGTGTGG + Intergenic
955120516 3:56053358-56053380 GTGAGGGATGGGGAGAAGTGGGG + Intronic
956056158 3:65301050-65301072 GTGAGGTATGGGAAGGGGTATGG + Intergenic
956835066 3:73089890-73089912 GTGAGGACAGGGATGGGGTGGGG + Intergenic
957564280 3:81865073-81865095 GTGAGGAAGGGGAAGGGGGAGGG - Intergenic
959189079 3:103086562-103086584 CTGAGGGATGGGAAGGTTGGAGG - Intergenic
960580270 3:119272151-119272173 GTAAGGAAGGGTAAGGTGTAAGG - Intergenic
961735985 3:129002440-129002462 ATGCGGAGTGGGATGGTGTGGGG - Intronic
962206984 3:133442821-133442843 GTGGGGAAAGGGAAGATTTGTGG + Intronic
962317040 3:134365398-134365420 GTGTGCAATGGGAATGTGAGAGG - Intronic
962596799 3:136954584-136954606 GGGAGGGATGGGAAGTTTTGTGG - Intronic
962992645 3:140593048-140593070 GTGTTGAATGGGTAGGAGTGGGG - Intergenic
963135412 3:141899083-141899105 GAGAGGAATGGGAATGGGTATGG + Intronic
963260566 3:143187480-143187502 GTAGGGGATGGAAAGGTGTGTGG + Intergenic
963918820 3:150886438-150886460 GAGAGAAATGGGGAGGGGTGAGG + Intronic
964394867 3:156234618-156234640 GTGAAGAATGGGAAGATGAAAGG + Intronic
965448770 3:168810238-168810260 AAGAGGAATGAGAAGTTGTGAGG + Intergenic
965689846 3:171344003-171344025 TTGAGCAATGGGAAGGAGGGAGG - Intronic
965702406 3:171471385-171471407 GTAAGGAATGGGGAGTTGTTTGG + Intergenic
966031714 3:175356919-175356941 GTGCTGAATGTGAAAGTGTGAGG + Intronic
966199150 3:177343362-177343384 GAGAGGAAAGGGAAAGGGTGAGG - Intergenic
966285158 3:178286760-178286782 GTGAGGTATGGGAAGGGACGTGG - Intergenic
966820368 3:183919679-183919701 GTGGGGAGTGGAAAGGTGAGTGG - Intergenic
967598662 3:191358125-191358147 GTGAGGATTTGGGAGGTGGGAGG + Intronic
967884295 3:194322633-194322655 GAGAAGAATGGGCATGTGTGTGG + Intergenic
967987963 3:195109486-195109508 GTGAGGTATGTGTACGTGTGTGG + Intronic
968640136 4:1710313-1710335 GCTAGGCATGGGAAGTTGTGAGG - Intronic
968647983 4:1749410-1749432 GTGGGGAAGGGGGAGGTGGGGGG - Intergenic
968931196 4:3580396-3580418 ATGATGAATGGAAAGGTGGGTGG - Intronic
968938328 4:3624957-3624979 GTGGGGTATGGGAAGGACTGGGG + Intergenic
968974862 4:3816725-3816747 GAGAGGGATGGGAAGGCTTGTGG - Intergenic
969413935 4:7046701-7046723 GTGTGGAAGGAGATGGTGTGGGG + Intronic
969501124 4:7553808-7553830 GAGAGGAAGGTGAAGGTGGGAGG + Intronic
970124878 4:12797871-12797893 GAGTGGAAGGGGAAAGTGTGGGG - Intergenic
970658144 4:18254669-18254691 GGGAAGAATGGGAGGGGGTGAGG - Intergenic
971311581 4:25529949-25529971 GGGAGGAAAGGGAAGGAGAGGGG + Intergenic
971420289 4:26468062-26468084 GAGAGGAATGGGAAGGGAGGGGG + Intergenic
971506359 4:27370267-27370289 GTGAGAAAAGGGAAGGGGAGGGG - Intergenic
972364677 4:38363317-38363339 ACAAGGAATGGGAAGGTGAGGGG - Intergenic
972575023 4:40343624-40343646 CTGAGGAAAGGGAAGGTAAGAGG + Intronic
973104372 4:46315513-46315535 TTGAGGAATGTCAAGGAGTGGGG - Intronic
973189677 4:47372805-47372827 GTGAGTTCTGGGGAGGTGTGGGG + Intronic
973571057 4:52240053-52240075 GTGATGAAGGGGAGGGAGTGTGG - Intergenic
974165343 4:58194767-58194789 GGGAAGAGTGGGAAGGAGTGAGG + Intergenic
974173213 4:58293374-58293396 GTAAGGAATGGAAAGGGGAGTGG + Intergenic
974332164 4:60495318-60495340 GTGAAGAATGGGATGCTTTGGGG - Intergenic
974447909 4:62010304-62010326 GTGTTGAGGGGGAAGGTGTGTGG - Intronic
974586303 4:63883084-63883106 GTGAGGAAGGGGATGGGGGGTGG - Intergenic
975197418 4:71541746-71541768 GAGTGGAAAGGGAAGGTGGGTGG + Intronic
975807393 4:78127149-78127171 GTAAGGAATGGGTGGGGGTGGGG + Intronic
976274045 4:83258130-83258152 GGGAGAAATGGGGAGGTATGGGG + Intergenic
977584238 4:98758160-98758182 GATAGGAATGGGAAAGTGAGGGG - Intergenic
977763603 4:100771190-100771212 GGAAGGAATGGGAAGGAGGGAGG + Intronic
978311631 4:107390753-107390775 ATGAGGAATGGGAGGATGAGGGG + Intergenic
980075179 4:128287350-128287372 GTGAGGAGTTGGAAGGGGAGGGG - Intronic
980996950 4:139788295-139788317 GAGAGAAATGGGAGGGAGTGCGG - Intronic
981937412 4:150251326-150251348 GTGGGGGATGGGAGTGTGTGGGG - Intronic
982449538 4:155535835-155535857 GTGAAGGAAAGGAAGGTGTGAGG + Intergenic
984291399 4:177799524-177799546 GGGAGGAATGGGGAAGTTTGAGG + Intronic
984784365 4:183554148-183554170 GTGAGGGTTGTGAGGGTGTGAGG + Intergenic
985484847 5:142324-142346 GTGAGGCATGTGACTGTGTGTGG - Intronic
985746490 5:1651609-1651631 GTGGGGGATGGGGAGGGGTGAGG + Intergenic
985746512 5:1651658-1651680 GTGGGGGATGGGGAGGGGTGAGG + Intergenic
985997622 5:3605603-3605625 GTGGGGAATGCGTAGATGTGTGG + Intergenic
986147192 5:5089361-5089383 TTGAGGAATGGGTTGGTGTGGGG + Intergenic
986517735 5:8581239-8581261 GTGAGGAGAGGGCAGGTATGAGG - Intergenic
987061382 5:14247063-14247085 GTGGGGAAGGGGGAGGTGGGGGG - Intronic
987729082 5:21744409-21744431 GAGAGGAGAGGGAAGGTGAGAGG + Intergenic
988445344 5:31280130-31280152 CTGAAGAAGGGGAAGGTGTAGGG + Intronic
988502630 5:31796335-31796357 GTGAGGACGGGAAAGCTGTGGGG + Intronic
988968010 5:36439407-36439429 GTAAGGAATGGAAAAGAGTGAGG + Intergenic
990375677 5:55168142-55168164 GGGAAGAGTGGGAAGGAGTGTGG - Intronic
990852943 5:60227609-60227631 GGGAGGAAAGGGAAGGAGGGAGG + Intronic
991919575 5:71642279-71642301 GGGAGGAATGAGAAGGTGGGAGG + Intronic
992565903 5:77994917-77994939 GTGAGGAGTGGAAAGGTCTGGGG - Intergenic
993204195 5:84859564-84859586 GTGGGAAATGGGGATGTGTGAGG + Intergenic
994388678 5:99163531-99163553 CTCAGAAATGGGAAGGTGGGAGG + Intergenic
994682717 5:102909131-102909153 GAGAGAATTGGGAAGGTGTGAGG - Intronic
995358213 5:111263946-111263968 GGGAAGAATGGGAAGAGGTGAGG - Intronic
995865708 5:116688274-116688296 GGGAGGAATGGGAGGGAGGGAGG - Intergenic
996701855 5:126457804-126457826 GAGAGGATCGGGGAGGTGTGTGG + Intronic
997164292 5:131642318-131642340 CTCAGGAATGGGAAGCAGTGGGG + Intronic
997266188 5:132496646-132496668 GAGCGGAAGGGGAAGGTGGGGGG - Intergenic
997367367 5:133334731-133334753 GGGAGGGGTGGGAAGGTGCGGGG + Intronic
997428196 5:133818748-133818770 GTGAGGCAGGGGAAGGTGTAGGG - Intergenic
997593798 5:135092695-135092717 GTGAGGAAGGAGAGGGTGTATGG - Intronic
998003280 5:138640893-138640915 CTGAGGGGTGGGGAGGTGTGAGG + Intronic
998603188 5:143605717-143605739 GTAGGGAATGGGAAGGTAAGTGG + Intergenic
998642480 5:144026940-144026962 GTAAGGAATGGGAATGGGAGAGG + Intergenic
999000958 5:147922404-147922426 GTGAGCAATGAGGAGCTGTGGGG + Intergenic
999540702 5:152569495-152569517 ATGAGGAATGGGATGTTTTGTGG + Intergenic
1000330513 5:160201630-160201652 GTGAGAAATGAGAAGGGGAGAGG - Intronic
1000944171 5:167400247-167400269 GAGAGTGATGGGAAGGAGTGAGG + Intronic
1001147817 5:169200156-169200178 CTCAGGAAAGGGAAGGGGTGAGG + Intronic
1001648823 5:173301264-173301286 GGGAGGAAAGGGAAGGGGAGGGG - Intergenic
1001650701 5:173314017-173314039 CTGAAGTAGGGGAAGGTGTGTGG + Intergenic
1001715949 5:173816159-173816181 GTGAGGAGTGAGATGGTGGGTGG - Intergenic
1002186693 5:177458014-177458036 GGGAGGGATGGGAGGGAGTGGGG - Intronic
1002700926 5:181124406-181124428 TTGAGGAATGGGGAGGTGATGGG - Exonic
1003128292 6:3373539-3373561 GTGAGGCATAGGAAGGCCTGGGG + Intronic
1004702332 6:18091045-18091067 GTGAGCAATGGCAAGGAGGGAGG - Intergenic
1005364140 6:25060511-25060533 GTGTGGAAAGGGGAGGGGTGTGG + Intergenic
1005903685 6:30241865-30241887 GAGAGGAAGGGGTATGTGTGTGG + Intergenic
1005952315 6:30641161-30641183 GTGAGGAAGAGGAAGGAGTGGGG - Intronic
1006116788 6:31779877-31779899 GTGAGGACTGGGAAGGGGATGGG + Intronic
1006299543 6:33186231-33186253 AGGAGGAATGGGAAGGAGTAGGG - Intronic
1006735753 6:36271191-36271213 GAGAAGAATAGGAAGGGGTGGGG + Intronic
1006889951 6:37418185-37418207 CGGAGGAATGGGAAGGGGAGAGG + Intergenic
1006927074 6:37662676-37662698 GTGAGGAATGAGAAGATGCAAGG + Intronic
1007134473 6:39507945-39507967 AGGAGGAAGGGGAAGGGGTGGGG - Intronic
1007405132 6:41631068-41631090 GTGAGAGATGGGAAGGCATGAGG + Intergenic
1007711099 6:43824866-43824888 GGAGGGAATGGGAAGGTGGGGGG + Intergenic
1007737787 6:43992622-43992644 GTGAGGATTAAGAATGTGTGAGG - Intergenic
1007827758 6:44613908-44613930 CTGAGGAAGGGGAAGGTTTTGGG + Intergenic
1008957654 6:57233613-57233635 GGGAGGAAAGGGAAGGAGGGAGG - Intergenic
1010060123 6:71613272-71613294 GTGAGAAAGGGGCAGGGGTGAGG - Intergenic
1010154045 6:72771181-72771203 GAGGGGAATGGGTGGGTGTGGGG + Intronic
1010389670 6:75322389-75322411 TTGAAGAATGGGAAGGTGAGCGG - Intronic
1010463284 6:76138041-76138063 GTGAGGTAGGGGAAGGGGGGAGG - Intergenic
1010566296 6:77418256-77418278 CGGAGGAGTGGGAAGGTGAGGGG - Intergenic
1010788132 6:80029637-80029659 GTCAGGAAGGGGAAGGAGTGAGG + Intronic
1011554945 6:88564265-88564287 GTGAGGGTTAGGGAGGTGTGAGG - Intergenic
1011989437 6:93495132-93495154 CTGAGGATTGTGAAGGTCTGAGG - Intergenic
1013048429 6:106510323-106510345 GTGGGGACTGGGTAGGTGCGGGG - Intergenic
1013295358 6:108753823-108753845 AAGAGGAAGGGGAAGATGTGAGG - Intergenic
1013305835 6:108846624-108846646 GAGTGGAAAGGGAAGATGTGTGG + Intergenic
1013967068 6:115967591-115967613 GCGAAGTATGGGAAGGTCTGTGG - Exonic
1014249273 6:119099186-119099208 GTGAGGTATGGGAAGGGGTGTGG - Intronic
1014249361 6:119099787-119099809 GTGAGGTATGGGAAGGGGTGTGG - Intronic
1014285545 6:119493360-119493382 GGAAAGAATGGGAAGGAGTGAGG + Intergenic
1015065955 6:129027970-129027992 GTGAGGAATGGGGACTTCTGTGG + Intronic
1015140701 6:129928241-129928263 ATGAGAAATGAGAAAGTGTGTGG + Intergenic
1015710030 6:136129486-136129508 GTGGGGAGTGGGGAGGGGTGTGG - Intronic
1016391451 6:143579627-143579649 GTGAGACCTGGGAAGGTGAGCGG + Intronic
1016567419 6:145472017-145472039 GAGAGGAGAGGGAAGGAGTGGGG + Intergenic
1016804315 6:148197580-148197602 GTGAGGAAGGAGAAGCTTTGAGG - Intergenic
1016920159 6:149284912-149284934 GTGGGCATTAGGAAGGTGTGGGG - Intronic
1017867453 6:158456149-158456171 GTAAGTTATGGGAAGGTGAGGGG + Intronic
1018207603 6:161450173-161450195 GTGAAGAGGGGGAAGGTGTATGG + Intronic
1018429700 6:163713412-163713434 GTAGGGAATGGGAAGGAGTGGGG - Intergenic
1018528820 6:164742093-164742115 GGGAGGATTGAGAAGGTGGGAGG - Intergenic
1018528928 6:164742431-164742453 GGGAGGAGTGAGAAGGTGAGAGG - Intergenic
1018963211 6:168463527-168463549 TGGAGGAATGTGAAGATGTGGGG + Intronic
1019057456 6:169233563-169233585 GTGACGCATGGGTAGTTGTGTGG - Intronic
1019064835 6:169288174-169288196 CTGAGAAGTGGGAAGGGGTGAGG - Intergenic
1019532704 7:1511610-1511632 GTGAGGAAGGGGAAGGACTCTGG + Intergenic
1019717215 7:2544876-2544898 ATGAGGAATGGGGTGGGGTGTGG + Intronic
1019864818 7:3698100-3698122 GGGAGGAAGGGGAGGGTTTGGGG - Intronic
1020066485 7:5191675-5191697 GTGAGGAAAGAGAAGGAGTGGGG + Intronic
1020080227 7:5282811-5282833 GTGAGGAAGGGGGAGGGGAGGGG + Intronic
1022794619 7:33722317-33722339 GCGAGGAATGGCAATGTTTGGGG - Intergenic
1023530107 7:41144197-41144219 GTGATGAAAGGGAAGGAGTATGG - Intergenic
1023926714 7:44674897-44674919 GTGAAAATAGGGAAGGTGTGGGG + Intronic
1024022633 7:45385828-45385850 GTAGGGAATGGGAAGGTGGAAGG + Intergenic
1024112047 7:46157187-46157209 GGGAGGAGTGGGAAGGGGTGGGG + Intergenic
1024506745 7:50168264-50168286 GTGAGAAATGGGAGGCTTTGAGG - Intergenic
1025108257 7:56191053-56191075 ATAAGGAATGTAAAGGTGTGGGG + Intergenic
1025147099 7:56514339-56514361 GGGAGGGAGGGGAAGGAGTGAGG - Intergenic
1025610295 7:63071614-63071636 GTGCAGCATGGGAGGGTGTGGGG - Intergenic
1025790007 7:64680373-64680395 CTGAAGAATGGGAGGGTGTTTGG + Intronic
1026855273 7:73749406-73749428 ATGAGGAATGGGATGGGGAGGGG + Intergenic
1027266818 7:76499085-76499107 GTGAGGTGTGTGGAGGTGTGGGG + Intronic
1027318205 7:76997225-76997247 GTGAGGTGTGTGGAGGTGTGGGG + Intergenic
1027318244 7:76997390-76997412 GTGGGGTGTGTGAAGGTGTGGGG + Intergenic
1027318276 7:76997529-76997551 GTGGGGTCTGTGAAGGTGTGAGG + Intergenic
1027318432 7:76998208-76998230 GTGTGGGATGTGGAGGTGTGGGG + Intergenic
1027339318 7:77189175-77189197 GTGAGGAGTGGAATGGAGTGGGG - Intronic
1028651251 7:93152528-93152550 GTGGGGATTGGGAAGGGGGGGGG + Intergenic
1029438483 7:100575066-100575088 GAGAGGAAGGGAAAGGGGTGAGG + Exonic
1030077761 7:105751204-105751226 GGGATGGATGGGAAGGTGGGAGG + Intronic
1030166762 7:106562978-106563000 GTGAGGGAGGGGAGGGAGTGAGG + Intergenic
1030339353 7:108359133-108359155 TTGATGGATTGGAAGGTGTGGGG - Intronic
1031709995 7:125033681-125033703 GTGAGCAATGAGGAGCTGTGGGG + Intergenic
1031989250 7:128186354-128186376 GGGAGGAAAGGGAAGGAGGGAGG - Intergenic
1032036828 7:128527644-128527666 GTTAGGAATGGGAAGAAGAGAGG + Intergenic
1032419477 7:131766242-131766264 GAGAGGAATGGGAAGCTGAGTGG - Intergenic
1032699930 7:134370599-134370621 CTGGGGAATGGGCAGGAGTGGGG + Intergenic
1033127520 7:138718591-138718613 GGGAGGAATGGGGAGGAATGGGG + Intronic
1033127524 7:138718601-138718623 GGGAGGAATGGGGAGGAATGGGG + Intronic
1033499696 7:141935695-141935717 GTGAGGAATGGAGAGGTGGCTGG - Intronic
1033589549 7:142797804-142797826 TTGGGGAATGGGTAGGAGTGGGG + Intergenic
1033943235 7:146681500-146681522 GTGGGGAGTGGGAGGGTGGGAGG + Intronic
1034139618 7:148803555-148803577 GCCAGGAATCTGAAGGTGTGGGG - Intergenic
1034412091 7:150947117-150947139 GTGGGGAAGGGGAAGGGGAGGGG + Intronic
1034412435 7:150948330-150948352 GGAAGGGATGGGAAGGTCTGAGG + Intronic
1034495132 7:151416319-151416341 GTGAGGGAGTGGGAGGTGTGGGG - Intergenic
1034539611 7:151748415-151748437 GGGAAAACTGGGAAGGTGTGGGG + Intronic
1034751657 7:153574589-153574611 ATGAGGCATTGGAATGTGTGGGG + Intergenic
1034937395 7:155208926-155208948 GTGGGGAATGTGAGTGTGTGTGG + Intergenic
1035088122 7:156278935-156278957 CAGAGGAATGGGAAGGGTTGAGG + Intergenic
1036208940 8:6826637-6826659 GTGAGGAATGTGAGGATGGGTGG + Intronic
1036465240 8:8991333-8991355 GTGTGAAATGGGGAGGTGTCTGG + Intergenic
1037147680 8:15592986-15593008 GTGAGGAAAGGTCAGGTTTGGGG + Intronic
1037762277 8:21749503-21749525 GTGAGGAATGGGTCAGGGTGAGG - Intronic
1037908778 8:22730941-22730963 GTGAGGAGGCCGAAGGTGTGAGG - Intronic
1039407600 8:37326619-37326641 GAGAGGAAAGGGAAGGAGAGGGG - Intergenic
1039971767 8:42326477-42326499 GGGAAGAATGGGAAGGTCAGTGG - Intronic
1040893053 8:52337600-52337622 ATGAGCAGTGTGAAGGTGTGGGG + Intronic
1041794529 8:61732769-61732791 GTTAGGAAAGGGAGGGTGTACGG + Intergenic
1042390638 8:68229742-68229764 GACAGGAATGGGAAGATGGGTGG - Intronic
1042781908 8:72500556-72500578 GAGAGGAAAGGGAAAGTGGGGGG + Intergenic
1043332174 8:79130952-79130974 CTGAGGAAAGGGAAGTTCTGAGG - Intergenic
1044310690 8:90688624-90688646 GGGATGACTGGGAAGGAGTGTGG - Intronic
1044529933 8:93295799-93295821 TTCAGGAAAGGGAAGGTGTTTGG - Intergenic
1044831501 8:96254407-96254429 GGGAGGAATGGGGAGTTGTTGGG - Intronic
1045358530 8:101411253-101411275 GTGAGGAATAGCAAGGACTGTGG + Intergenic
1045790431 8:105977892-105977914 GTGAGGGTTGGGAAGGTCTGGGG - Intergenic
1045950723 8:107848936-107848958 GGGAGGAAGGGGAAGGGGAGGGG + Intergenic
1047006048 8:120621451-120621473 GTGAGAAATGGGAAAGTGGAGGG + Intronic
1047573868 8:126131853-126131875 GGAAGGAATTGGAAGGTGGGAGG - Intergenic
1048340291 8:133533548-133533570 GGGAGGAATGGGGAGCTGGGAGG - Intronic
1048744021 8:137593233-137593255 GTGAGGAATGGGGAGGTCAGAGG - Intergenic
1048862173 8:138731554-138731576 CAGGGGAATGGGCAGGTGTGTGG + Intronic
1049013949 8:139906579-139906601 GAGAGGATTGGGAAGGAGAGAGG + Intronic
1051899117 9:22019466-22019488 ATGAGGGAAGGGAAGGTGTTAGG + Intronic
1053216705 9:36277543-36277565 GAGTGGAATGTGAAGTTGTGTGG - Intronic
1053372364 9:37573536-37573558 GTCAGGAATGACAATGTGTGTGG + Intronic
1053505600 9:38640913-38640935 CTGAGGAAAGGGAAGCTGAGAGG + Intergenic
1054458959 9:65451674-65451696 ATGATGAATGGAAAGGTGGGTGG + Intergenic
1055015593 9:71614451-71614473 GTGAGGAAAGGGCAGGTGGGAGG + Intergenic
1055705725 9:79000577-79000599 GTGAGGAATGAGAAGCTTTTGGG - Intergenic
1055712358 9:79077186-79077208 GAGAGGAGTGGGTAGGTTTGGGG - Intergenic
1055800863 9:80034003-80034025 GTGAGGAATGGGGAGGTCCCAGG + Intergenic
1056496407 9:87159802-87159824 GTGAGGGATGGGAGGGAGTCTGG + Intergenic
1056550187 9:87646362-87646384 TTGAGACAGGGGAAGGTGTGTGG + Intronic
1056578718 9:87874784-87874806 GTGAAGTATGGGAAGGGGCGTGG + Intergenic
1056761193 9:89416149-89416171 GTTAGTGCTGGGAAGGTGTGGGG + Intronic
1057279991 9:93702180-93702202 GTCAGGACTGGGAGGGGGTGGGG + Intergenic
1057334394 9:94144349-94144371 GCGGGAAATGGGAAGCTGTGGGG - Intergenic
1057516377 9:95725325-95725347 GTATGGAGTGGGAAGGGGTGAGG + Intergenic
1057700597 9:97360829-97360851 GTGAGGTGTGGGCAGGGGTGGGG - Intronic
1057854656 9:98593373-98593395 GTGAGGAAGGGCAGGGCGTGGGG + Intronic
1057880930 9:98792155-98792177 GTCAGGATGGTGAAGGTGTGGGG - Intronic
1058346530 9:103970190-103970212 GTGAGAGAGGGGAAGGTGGGGGG - Intergenic
1058958264 9:109969282-109969304 GTGAGGAAGCACAAGGTGTGGGG - Intronic
1058971365 9:110086158-110086180 CTGAGAAGTGGGAGGGTGTGGGG + Intronic
1059928168 9:119233547-119233569 GAGAGGCATGGGAAAGTGGGAGG - Intronic
1060263622 9:122096218-122096240 GTGGAGAATGGGTGGGTGTGTGG - Intergenic
1060474117 9:123974359-123974381 AAGAGGAATGGGAAGGGGAGGGG + Intergenic
1060679785 9:125552017-125552039 GGGAGGAATGGGAAGGTTTTTGG - Intronic
1060983084 9:127804538-127804560 GGGACGAAGGGGAAGGTGAGGGG + Exonic
1061127379 9:128685430-128685452 GGAAGGGATGGAAAGGTGTGAGG + Intronic
1061521696 9:131122071-131122093 GTTAGGAAGGGGGAGGTATGGGG + Exonic
1061902216 9:133678719-133678741 GTGAAGAATGGGGAGCCGTGTGG - Intronic
1061999000 9:134206662-134206684 GAGAGGAAGGGGAGGGTGGGAGG + Intergenic
1062096864 9:134708075-134708097 GAGAGGACTGGGGAGGTGTCCGG + Intronic
1062108551 9:134768970-134768992 GTGTGGAGGGGGGAGGTGTGAGG + Intronic
1062194178 9:135263991-135264013 GGGAGGAAAGGGAAGGGGAGGGG - Intergenic
1062227719 9:135462896-135462918 GCTGGGAATGGGAAGGTGAGGGG - Intergenic
1062443993 9:136585771-136585793 GTGAGGGATGGGGATGGGTGTGG - Intergenic
1062453966 9:136627139-136627161 GTGTGGGCTGGGATGGTGTGGGG - Intergenic
1203446636 Un_GL000219v1:63216-63238 GTAAGGAAAGGGAAGGAGGGAGG - Intergenic
1185545746 X:942586-942608 GAGAGGAAAGGGGAGGTGTATGG + Intergenic
1185765549 X:2723273-2723295 GTCTGCAATGGGAAGGTTTGGGG - Intronic
1187934335 X:24321270-24321292 GGGATGAAGGGGGAGGTGTGGGG + Intergenic
1189282348 X:39827757-39827779 GTGGGGAGGGGGCAGGTGTGGGG - Intergenic
1190550083 X:51570776-51570798 GTGAGGGGTGGTAAGTTGTGGGG + Intergenic
1190616140 X:52234546-52234568 TTGAAGGATGGGAAGGTGGGAGG - Intergenic
1190709458 X:53055980-53056002 GTGAGTAATTGGATGGGGTGTGG + Intronic
1190984020 X:55484416-55484438 GTGAGAAATAGCCAGGTGTGTGG - Intergenic
1191249397 X:58253293-58253315 GTGAGGAATGGGCCTGGGTGAGG - Intergenic
1191661598 X:63657314-63657336 GTTAGGATTGGGAATGTGAGTGG - Intronic
1192216733 X:69164576-69164598 GGAAGGCATGGGAGGGTGTGAGG + Intronic
1193363379 X:80601671-80601693 GTTCTGAAAGGGAAGGTGTGAGG + Intergenic
1195118387 X:101723284-101723306 GTGAGGTATGAGAAGGAGCGTGG - Intergenic
1195631734 X:107063194-107063216 GGGGGGAATGGGAAGGGCTGGGG - Intergenic
1195937473 X:110139434-110139456 GCGAGGATGGGGAAGGTCTGAGG + Intronic
1195960732 X:110383534-110383556 GTCAGGATTGTGAAGGGGTGGGG - Intronic
1195996433 X:110736293-110736315 GAAAGGAAAGGGAAGGTGTTAGG + Intronic
1196207544 X:112957832-112957854 GTAAGCAAAGGAAAGGTGTGTGG - Intergenic
1196824660 X:119731636-119731658 GTGAGCCATGGCAAGGAGTGGGG + Intergenic
1197668580 X:129250378-129250400 GGGAAGAGTGGGAGGGTGTGAGG - Intergenic
1197807469 X:130411613-130411635 GTGTGAAAGGGGAAGGTGTGGGG + Intronic
1200216002 X:154368550-154368572 CTGAGGAAGAGGAAGGTGGGTGG + Intronic
1200599077 Y:5183375-5183397 GAGAGGAATAAGAAGGGGTGAGG - Intronic
1201136070 Y:10991077-10991099 GAGTGGAATGGGATGGAGTGAGG - Intergenic
1201341119 Y:12935552-12935574 GGGAGGAAAGGGAAGGAGGGAGG - Intergenic
1202301846 Y:23424263-23424285 TTGAGGCATGGCAAGGTTTGTGG - Intergenic
1202568965 Y:26246335-26246357 TTGAGGCATGGCAAGGTTTGTGG + Intergenic