ID: 900208133

View in Genome Browser
Species Human (GRCh38)
Location 1:1440169-1440191
Sequence TCCTGGACGTTGATAGGAAG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 79}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900208118_900208133 22 Left 900208118 1:1440124-1440146 CCGGGCCCCAAGTGGCAAGGGCT 0: 1
1: 0
2: 4
3: 17
4: 232
Right 900208133 1:1440169-1440191 TCCTGGACGTTGATAGGAAGCGG 0: 1
1: 0
2: 0
3: 10
4: 79
900208121_900208133 16 Left 900208121 1:1440130-1440152 CCCAAGTGGCAAGGGCTGGCCTG 0: 1
1: 0
2: 5
3: 16
4: 185
Right 900208133 1:1440169-1440191 TCCTGGACGTTGATAGGAAGCGG 0: 1
1: 0
2: 0
3: 10
4: 79
900208130_900208133 -3 Left 900208130 1:1440149-1440171 CCTGGGGCGGGCAGCTTGGGTCC 0: 1
1: 0
2: 0
3: 17
4: 173
Right 900208133 1:1440169-1440191 TCCTGGACGTTGATAGGAAGCGG 0: 1
1: 0
2: 0
3: 10
4: 79
900208120_900208133 17 Left 900208120 1:1440129-1440151 CCCCAAGTGGCAAGGGCTGGCCT 0: 1
1: 0
2: 2
3: 23
4: 237
Right 900208133 1:1440169-1440191 TCCTGGACGTTGATAGGAAGCGG 0: 1
1: 0
2: 0
3: 10
4: 79
900208122_900208133 15 Left 900208122 1:1440131-1440153 CCAAGTGGCAAGGGCTGGCCTGG 0: 1
1: 0
2: 4
3: 42
4: 335
Right 900208133 1:1440169-1440191 TCCTGGACGTTGATAGGAAGCGG 0: 1
1: 0
2: 0
3: 10
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900208133 Original CRISPR TCCTGGACGTTGATAGGAAG CGG Exonic
900208133 1:1440169-1440191 TCCTGGACGTTGATAGGAAGCGG + Exonic
902584491 1:17430161-17430183 TCCTGGACGTGAAAAGGAAAGGG + Intronic
904291925 1:29491960-29491982 TCCTGGACGTTCATATGAAAAGG + Intergenic
905484572 1:38286209-38286231 TCCTGGTCACTGAAAGGAAGAGG + Intergenic
906102559 1:43272593-43272615 TCCTGGACTGTGAGAGGAATGGG + Exonic
911233757 1:95387422-95387444 TGCTGGAGGTTGATAGTGAGTGG + Intergenic
912519343 1:110234523-110234545 TCCTGGGCCTGGATAGGACGGGG + Intronic
1063644757 10:7867999-7868021 TCCTGGTCATTGAGTGGAAGTGG + Intronic
1065633065 10:27701991-27702013 TCCTGGAGATTGGTAGGAGGAGG - Intronic
1068181484 10:53524602-53524624 TCCTGGACTTTCATAAGAAGGGG + Intergenic
1072970896 10:100016502-100016524 TTCTGCAAGTAGATAGGAAGAGG - Intergenic
1082870684 11:57941914-57941936 TCCTGGACACTGCCAGGAAGTGG - Intergenic
1083498513 11:63080932-63080954 TCCTGGATGGTGTTAGGAAGAGG + Exonic
1084859577 11:72009483-72009505 TCCTGCACTTTCTTAGGAAGCGG + Intronic
1085037838 11:73310382-73310404 TCCTGGACGATGAGGGGCAGCGG - Exonic
1085582173 11:77662364-77662386 TCCTGGAAGTCGATTAGAAGAGG - Exonic
1087524205 11:99287291-99287313 TCCTGGACATTGACCAGAAGAGG + Intronic
1091196415 11:133734678-133734700 TCCTGAACGTTGACAGGCATGGG + Intergenic
1091382378 12:70226-70248 TCCTGGAATTGGGTAGGAAGAGG - Intronic
1094566824 12:31606533-31606555 TCCAGGACTTTGGTAGGCAGAGG - Intergenic
1099718626 12:86331682-86331704 TCCTGGTGGTTGGTAGGGAGGGG + Intronic
1106016413 13:25873366-25873388 TCCTGAATGTTGGAAGGAAGAGG + Intronic
1107382798 13:39875480-39875502 TCCTGGGGGTTGGGAGGAAGAGG + Intergenic
1111907195 13:94269118-94269140 TCCTGCAGGTACATAGGAAGTGG + Intronic
1114242652 14:20882804-20882826 TCCTGGAGGTGAACAGGAAGAGG + Intergenic
1114249583 14:20946731-20946753 TCCTGGAGGTGAACAGGAAGAGG + Intergenic
1114686272 14:24534711-24534733 TCCCGGAAGTGGAAAGGAAGAGG - Intergenic
1120193367 14:81459570-81459592 TGCTGGACTGTGAAAGGAAGCGG - Intergenic
1122057158 14:99108227-99108249 TCCAGGACTTTGAGAGGCAGAGG - Intergenic
1122554211 14:102568313-102568335 TCCTGGAGGTGCAGAGGAAGAGG - Intergenic
1124168435 15:27350577-27350599 CCCTGGACGTAGAGAGGAGGGGG - Intronic
1132273356 15:100545014-100545036 TACAGGCTGTTGATAGGAAGGGG + Intergenic
1133071127 16:3247327-3247349 TCCTGGAGGTGGATAAGAGGTGG + Intronic
1135753596 16:25077467-25077489 TCCAGCACTTTGATAGGATGAGG + Intergenic
1137884457 16:52087640-52087662 TCCTGGATCTGGAAAGGAAGGGG - Intergenic
1144998054 17:19284415-19284437 TCCTGGCTGTTCATTGGAAGTGG + Intronic
1147334556 17:39719548-39719570 TCCTTGTGGTGGATAGGAAGCGG - Intronic
1149032186 17:52096514-52096536 TCATAGCCGTTGATAGGATGGGG - Intronic
1151244393 17:72783394-72783416 TCCTGGCTGGTGATAGGAAGGGG - Intronic
1152435329 17:80272970-80272992 TCGTGGACATTGGGAGGAAGAGG + Intronic
1157597975 18:48875332-48875354 TCCTGGACCCTTTTAGGAAGGGG - Intergenic
1159101968 18:63968077-63968099 TCTTGGACCATGAGAGGAAGAGG - Intronic
1160783252 19:887789-887811 TCCTGGACATTCATAGAAACAGG - Intronic
1165914251 19:39248072-39248094 TCCTGGACGTGGATGGGTACTGG + Intergenic
1165916627 19:39264866-39264888 TCCTGGACGTGGATGGGTACTGG - Intergenic
1168131966 19:54327013-54327035 ACCTGGATGCTGATAGAAAGAGG - Intergenic
925187824 2:1861226-1861248 TCCCGGAGGGAGATAGGAAGTGG - Intronic
925338684 2:3117581-3117603 GCCTGGACTTTGATGGGAACAGG - Intergenic
926306337 2:11639841-11639863 TGCTGGGAGTTGAGAGGAAGGGG + Intronic
927307933 2:21595217-21595239 ACCTGGACGTTGCTATGAACTGG + Intergenic
935388297 2:102524209-102524231 TCCTGGAGGATGATAGGATTGGG - Intronic
938481271 2:131663656-131663678 TCCAGGACGTTGAGAGGCTGAGG - Intergenic
942432456 2:175927100-175927122 TACAGGACGTTGAGAGCAAGAGG + Exonic
947983205 2:234427234-234427256 GCCTGGAGGGTGAGAGGAAGTGG - Intergenic
1168747210 20:253831-253853 TCCTGGATCTGGAAAGGAAGGGG + Intergenic
1172528692 20:35616476-35616498 TCCTGGACGGTTATGGGAAGGGG + Intronic
1174115559 20:48224376-48224398 TACTGGACTCTGATTGGAAGTGG - Intergenic
1174165056 20:48578446-48578468 TCCTGGACTCTGATTGGAAGTGG + Intergenic
954736885 3:52714625-52714647 CCCTGGAGGTTGCTAGGATGGGG + Intronic
961832121 3:129628470-129628492 TCCTGGATGGGGATGGGAAGGGG - Intergenic
964525314 3:157610866-157610888 TCCTGGAGGTTGATATGATTTGG + Intronic
968781823 4:2588214-2588236 TGATGGAAGTTGAGAGGAAGGGG - Intronic
969213094 4:5702503-5702525 TACTGGAAGTTGATCAGAAGGGG - Intronic
969390413 4:6888427-6888449 CCCTGGACTGTGATAGGAAGTGG - Intergenic
970550845 4:17179374-17179396 TCTTGGCCGCTGGTAGGAAGAGG + Intergenic
970746078 4:19297634-19297656 TCTTAGAAGTTGATAGGAAGAGG - Intergenic
971722252 4:30260349-30260371 TCCTGGAAGTTGAGAGGATTGGG + Intergenic
974196769 4:58585301-58585323 TGCTAGAGGTTGATGGGAAGAGG - Intergenic
976131106 4:81884875-81884897 TCCTGGAGGTTAACAGGAAGGGG + Intronic
976917936 4:90402020-90402042 TCTGGGACGGGGATAGGAAGGGG - Intronic
978036242 4:103998838-103998860 TCCTGGAAGTGGAAAGGAAGGGG + Intergenic
979964389 4:127060655-127060677 TCCTGAACTTTGGTATGAAGTGG - Intergenic
980823600 4:138047253-138047275 AGCTGGACGTTGAGAGGAATGGG + Intergenic
983840467 4:172451501-172451523 TTCTAGAGGTTGATAGAAAGTGG + Intronic
986072323 5:4297240-4297262 TACTGGAAGTTGTTATGAAGTGG - Intergenic
1003197826 6:3930638-3930660 TCCTGGTTGTTGATTGGATGAGG + Intergenic
1007636752 6:43304223-43304245 TCCAGGACGTGGAGAGAAAGAGG + Exonic
1009296056 6:61949079-61949101 TCCTGGATGTTTATAGCATGGGG - Intronic
1012908219 6:105091675-105091697 TCCTGGACGTGGCTTGGAGGTGG - Intergenic
1015222054 6:130815040-130815062 TCCTGGAGATTGAGAGGCAGTGG + Intergenic
1029054815 7:97731322-97731344 TCCTGGATGTGGCAAGGAAGAGG + Intergenic
1034700718 7:153093433-153093455 GACTGGAGGCTGATAGGAAGTGG - Intergenic
1034873115 7:154701100-154701122 TCCTGGAGGATCATAGGAAATGG - Intronic
1037450515 8:19012505-19012527 TGCTGGACCTTGAAAGGGAGGGG - Intronic
1039217974 8:35294128-35294150 TCCTGAGCCTTGATAGGAAAAGG - Intronic
1040013817 8:42683902-42683924 TCTTGGAAGTGGATTGGAAGTGG + Intergenic
1056113517 9:83420209-83420231 TCATGGATGATGATAGAAAGTGG + Intronic
1186465330 X:9780241-9780263 TCCTGGTGGCTGAGAGGAAGTGG - Intronic
1197759731 X:130019610-130019632 TCCTGGAATTTGATGGGTAGTGG + Intronic
1198582533 X:138081746-138081768 CACTGGACGGTGATGGGAAGGGG + Intergenic