ID: 900210235

View in Genome Browser
Species Human (GRCh38)
Location 1:1451952-1451974
Sequence GCGTCCGCCCCAGGACCGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 1, 2: 0, 3: 2, 4: 73}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900210235_900210239 -9 Left 900210235 1:1451952-1451974 CCCTGCGGTCCTGGGGCGGACGC 0: 1
1: 1
2: 0
3: 2
4: 73
Right 900210239 1:1451966-1451988 GGCGGACGCAACCTCTGGATTGG 0: 2
1: 0
2: 0
3: 1
4: 41
900210235_900210241 9 Left 900210235 1:1451952-1451974 CCCTGCGGTCCTGGGGCGGACGC 0: 1
1: 1
2: 0
3: 2
4: 73
Right 900210241 1:1451984-1452006 ATTGGTGTTGAGCATTTTTCTGG 0: 2
1: 0
2: 9
3: 26
4: 297
900210235_900210242 18 Left 900210235 1:1451952-1451974 CCCTGCGGTCCTGGGGCGGACGC 0: 1
1: 1
2: 0
3: 2
4: 73
Right 900210242 1:1451993-1452015 GAGCATTTTTCTGGTTTTAAAGG 0: 2
1: 0
2: 0
3: 25
4: 339

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900210235 Original CRISPR GCGTCCGCCCCAGGACCGCA GGG (reversed) Intronic
900210235 1:1451952-1451974 GCGTCCGCCCCAGGACCGCAGGG - Intronic
902666140 1:17939919-17939941 GCGACGGCCCCAGGGCCCCAGGG - Intergenic
905205794 1:36342185-36342207 GCGTCAGTCCCGGGTCCGCAGGG - Intronic
907136361 1:52142521-52142543 GCTGAGGCCCCAGGACCGCAGGG - Intronic
913144606 1:115976776-115976798 GCGTCCGCTCCCAGACCGCCGGG + Intronic
915554159 1:156652190-156652212 GCGTCTGTCCAAGGACCGAAAGG - Intronic
920394062 1:205631469-205631491 GGGTCCGCCCCCGGCCCGCCGGG - Intronic
1072503665 10:96043670-96043692 GCGTCCGCCGCACGACGGCGGGG + Exonic
1076630073 10:131847032-131847054 TCGCCAGCCCCAGGACAGCAGGG + Intergenic
1076820990 10:132939497-132939519 GTGGCCGGCCCAGGACCACAAGG - Intronic
1077305504 11:1867027-1867049 GCCTCCTCCCCAGGTCCACAGGG - Intronic
1083401254 11:62424912-62424934 GCGTCCGCTCCAGGACCCTGTGG - Intergenic
1084733898 11:71092118-71092140 GCGTCCACCCCATAACTGCAGGG + Intronic
1092171281 12:6375374-6375396 GTCTCTGCCCCAGGACTGCAGGG + Intronic
1097198041 12:57255099-57255121 GCACCCGCCCCAGGACTGGAAGG + Exonic
1105240833 13:18609007-18609029 GCCTTCGCTCCAGGCCCGCACGG + Intergenic
1117478144 14:56118225-56118247 GCGCCCGCCCCCGGCCCGCGGGG - Intronic
1119793691 14:77376926-77376948 GCGGCCGCCTCAGGTACGCAAGG - Exonic
1122120322 14:99549805-99549827 GTGTCCTCCCCAGGACCTCTGGG - Intronic
1122794147 14:104197337-104197359 GGGTTGGCCCCAGGACAGCAAGG - Intergenic
1123111304 14:105868211-105868233 GCTTCTCCTCCAGGACCGCACGG - Intergenic
1123490523 15:20776133-20776155 GCCTTCGCTCCAGGCCCGCACGG - Intergenic
1123547024 15:21345220-21345242 GCCTTCGCTCCAGGCCCGCAGGG - Intergenic
1130230093 15:82090492-82090514 GTGGCCGCCCCAGGAATGCAGGG - Intergenic
1132289296 15:100688340-100688362 GTGTCCCACCCAGGACCCCAGGG + Intergenic
1202955356 15_KI270727v1_random:72436-72458 GCCTTCGCTCCAGGCCCGCACGG - Intergenic
1132500594 16:283043-283065 GCGGCCGCCCCCGGCCCCCAGGG - Intergenic
1139667800 16:68470578-68470600 GCTTCCTCCCCCAGACCGCAAGG - Intergenic
1142128471 16:88421586-88421608 TCCTCTGCCCCAGGACAGCAGGG - Intergenic
1143783265 17:9240315-9240337 GCGCCCGCCCCCGGGCCCCAGGG - Exonic
1144710508 17:17398668-17398690 GCAGCCTCCCCAGGACCACATGG - Intergenic
1144825921 17:18105716-18105738 GCCTCCGCCCCAGGGACGCTGGG + Intronic
1145060425 17:19729776-19729798 TCTTCCTCCCCAGGACTGCAGGG - Intergenic
1148911383 17:50944815-50944837 GGGGCCGCCGCAGGAGCGCAGGG - Intergenic
1151328557 17:73393569-73393591 GCGTCCGCTCCAGGATGGGAGGG + Exonic
1151572983 17:74936370-74936392 GCGCCCGGCCCAGCAGCGCAGGG - Intronic
1151894138 17:76968926-76968948 GAGTGCGCGGCAGGACCGCAGGG + Intergenic
1154448136 18:14450900-14450922 GCCTTCGCTCCAGGCCCGCACGG - Intergenic
1160594659 18:79965015-79965037 CAGGCCCCCCCAGGACCGCAGGG - Intronic
1167590062 19:50399517-50399539 GCCTCTGCCCCAGGAGCGCAGGG - Intronic
1167590078 19:50399562-50399584 GCCTCTGCCCCAGGAGCACAGGG - Intronic
925080612 2:1061239-1061261 GCGTCCAACCCAGGATCACACGG - Intronic
930619407 2:53628061-53628083 GTGTCCTCCCCAGGAGCCCACGG + Intronic
932497703 2:72154650-72154672 GCATTCGTCCCAGGACCCCAGGG + Intergenic
1174656683 20:52177565-52177587 GCGTCCTCCGCATGGCCGCATGG - Intronic
1176380484 21:6110320-6110342 GCGTCCGCCCGGGGCCCGCGCGG + Intergenic
1176448096 21:6839792-6839814 GCCTTCGCTCCAGGCCCGCAGGG + Intergenic
1176826266 21:13704814-13704836 GCCTTCGCTCCAGGCCCGCAGGG + Intergenic
1178864983 21:36320015-36320037 GCATGCGCCCTAGGCCCGCAGGG + Intergenic
1179742988 21:43427920-43427942 GCGTCCGCCCGGGGCCCGCGCGG - Intergenic
1183708006 22:39486961-39486983 GACTCCGCCCCAGGACAGAACGG - Intronic
950123233 3:10495625-10495647 GAGTCTGCCCCATGACCTCAGGG - Intronic
954389233 3:50260261-50260283 GCGGCCGCCCCAGGACAGAGCGG + Intergenic
954798753 3:53175026-53175048 GGGACCACCCCAGGACTGCATGG - Intronic
962606441 3:137036239-137036261 GGGTCGGCCCCAGGAGCCCATGG - Intergenic
966764395 3:183447331-183447353 GTTTCCGCCCAAGAACCGCAAGG - Intergenic
968601586 4:1512463-1512485 CCGGCAGCTCCAGGACCGCAAGG - Intergenic
968656053 4:1778909-1778931 GCGTGGCCCCCAGGACCTCAGGG + Intergenic
969540885 4:7788064-7788086 GGGTCGGCCTCAGGAGCGCAGGG + Intronic
970219583 4:13797008-13797030 GCGTCAGGCCCAGGACTGGACGG + Intergenic
985630075 5:1009460-1009482 GCGTCCGCCCCCGGACCGCAGGG + Exonic
1006644414 6:35506089-35506111 GCCTGCCCCCCAGGGCCGCACGG - Exonic
1015935670 6:138404315-138404337 GCGTCTGCCTCTGGACCGCGAGG - Exonic
1021688040 7:23206280-23206302 GCGGCCGCCCCAACACCGCGCGG + Intergenic
1022613054 7:31896250-31896272 GTGTCTGCCCCAGGACCAAAGGG + Intronic
1034429785 7:151035526-151035548 GCGTCCGCACCATGACAGGAAGG - Intronic
1034536304 7:151727955-151727977 GCGTCCGCCCCAGGGCCCTGAGG - Intronic
1039255934 8:35719005-35719027 GCTCCAGCCACAGGACCGCAAGG - Intronic
1045035055 8:98170242-98170264 ACGTCAGCCCCAGGGCTGCACGG - Intergenic
1045384771 8:101661377-101661399 TAGTCCTCCCCAGGACCTCAAGG - Intronic
1048881653 8:138877006-138877028 GCGCCCTCCCCAGGACAGGAAGG - Intronic
1049621308 8:143599520-143599542 GGGTCCGCCCGAGGGCTGCAGGG + Exonic
1060430595 9:123548168-123548190 GCTTCTGCCCCAGGACTTCAGGG - Intronic
1060993541 9:127862444-127862466 GCCTCCGGCCCAGGCCCTCAGGG + Intergenic
1061134215 9:128724048-128724070 CGGTCCGCACCAGGACCCCAGGG + Exonic
1061967829 9:134025895-134025917 GCGTCAGCCCCGGGACCGGAAGG - Intergenic
1203521094 Un_GL000213v1:44726-44748 GCCTTCGCTCCAGGCCCGCAGGG - Intergenic