ID: 900211768

View in Genome Browser
Species Human (GRCh38)
Location 1:1459710-1459732
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 349
Summary {0: 2, 1: 0, 2: 4, 3: 29, 4: 314}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900211768_900211779 24 Left 900211768 1:1459710-1459732 CCCTCCAGGCTTGGGGCCCACCC 0: 2
1: 0
2: 4
3: 29
4: 314
Right 900211779 1:1459757-1459779 GCCGCCCAGATGTCCCCCATAGG 0: 1
1: 1
2: 0
3: 6
4: 87
900211768_900211776 -2 Left 900211768 1:1459710-1459732 CCCTCCAGGCTTGGGGCCCACCC 0: 2
1: 0
2: 4
3: 29
4: 314
Right 900211776 1:1459731-1459753 CCGACTTTGTGTGGCCTCTGTGG 0: 2
1: 0
2: 0
3: 11
4: 90
900211768_900211781 25 Left 900211768 1:1459710-1459732 CCCTCCAGGCTTGGGGCCCACCC 0: 2
1: 0
2: 4
3: 29
4: 314
Right 900211781 1:1459758-1459780 CCGCCCAGATGTCCCCCATAGGG 0: 1
1: 1
2: 0
3: 5
4: 62
900211768_900211777 -1 Left 900211768 1:1459710-1459732 CCCTCCAGGCTTGGGGCCCACCC 0: 2
1: 0
2: 4
3: 29
4: 314
Right 900211777 1:1459732-1459754 CGACTTTGTGTGGCCTCTGTGGG 0: 2
1: 0
2: 0
3: 12
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900211768 Original CRISPR GGGTGGGCCCCAAGCCTGGA GGG (reversed) Intronic
900077355 1:827988-828010 GGGTCGGGCCCAGGGCTGGAGGG + Intergenic
900211768 1:1459710-1459732 GGGTGGGCCCCAAGCCTGGAGGG - Intronic
900224577 1:1527010-1527032 GGGTGGGCCCCAAGCCTGGAGGG - Intronic
900230683 1:1555527-1555549 GAGTGTGCCACAAGCGTGGACGG + Intronic
900593525 1:3470184-3470206 GGCTGGCCCCGAGGCCTGGAGGG + Intronic
900683176 1:3929082-3929104 GAGTGGGCCCCAAGCCGGTGGGG + Intergenic
901017325 1:6239391-6239413 GTGTTGTCCCCAAGCATGGAGGG - Intergenic
901050075 1:6421549-6421571 TGGTGGTCCGCAAACCTGGAGGG - Intronic
901630779 1:10647148-10647170 GGCTGGGCCCACAGCATGGAAGG - Intronic
901658722 1:10785621-10785643 GGGTGCTCCCCAGGCCTGGGTGG - Intronic
901739057 1:11330414-11330436 GGCTGGATCCCAAACCTGGAGGG + Intergenic
901875532 1:12165173-12165195 GGATGGGACCTAAGCCTGGGAGG + Intergenic
902411033 1:16211691-16211713 GGGTGGGCCAAACCCCTGGAGGG - Intronic
902874221 1:19331405-19331427 GGGTGGCTCCCAAAGCTGGAGGG - Intergenic
904463422 1:30693756-30693778 AGGTGGGCTCCAGGCCTGGCTGG - Intergenic
905266060 1:36755193-36755215 GGCTGGGCTCTAAGACTGGAAGG + Intergenic
905267211 1:36762854-36762876 GGGTGGGCCACCAGGCTGGGTGG + Intergenic
905363158 1:37434177-37434199 GGGAGGGCACCAGGCCTGGGTGG + Intergenic
905884095 1:41482441-41482463 AGGTGGGCACCCAGCCTGCAGGG - Intronic
906637226 1:47417357-47417379 GGGTGTGCTCCAAGCCAGGGTGG - Exonic
908248012 1:62243169-62243191 GGGTAGGCTGTAAGCCTGGAAGG - Intronic
908977828 1:69919962-69919984 GGAAGGGCCCCCAGTCTGGAAGG - Intronic
909320661 1:74281098-74281120 GGGAAGGACCCAGGCCTGGAAGG + Intronic
913275975 1:117138122-117138144 GGGTGGGCCCAAATCCAGTATGG + Intergenic
915359793 1:155278930-155278952 AGGTGGGTCACAAGCCTGGCGGG - Intronic
915514643 1:156405770-156405792 GGCTGGCTCCCAACCCTGGATGG - Intronic
916029508 1:160863755-160863777 GGGTGGCGTCCAAGCATGGATGG - Intergenic
919803147 1:201365470-201365492 GGATGGGCACCCAGCCTGGCTGG + Intronic
920099039 1:203505451-203505473 TGGTGGTCCCCGAGTCTGGAGGG + Intronic
922803797 1:228375646-228375668 GGGTGGGCACCCAGCCTCCAGGG - Intronic
923454441 1:234151089-234151111 GTGTGGGCCCCATCCCAGGAGGG - Intronic
1063110954 10:3037226-3037248 GGGTGTACACCAAGCCTGGCAGG + Intergenic
1063253729 10:4303247-4303269 GGGTGGACCCTAATCCAGGATGG - Intergenic
1064323120 10:14324484-14324506 CCCTGGGCCCCATGCCTGGATGG + Intronic
1065019781 10:21494811-21494833 CGCTCGGCCCCAAGCCTGGCAGG + Exonic
1065844178 10:29731216-29731238 GGGTTGGGCCCAGCCCTGGATGG - Intronic
1067540004 10:47144244-47144266 GGGAGACCCCCATGCCTGGATGG - Intergenic
1069886742 10:71628408-71628430 GGGTCTGCCCTAAGCCTGCATGG - Intronic
1072718100 10:97764969-97764991 GGGTGGGGCTCAAGCCTGGAAGG + Intergenic
1073006791 10:100330661-100330683 GGGTGGGGACCAAGGCTGGGAGG + Intergenic
1074434070 10:113418743-113418765 GGGTGGGCACCAAGTTTGGCTGG + Intergenic
1075947898 10:126454005-126454027 AGCTGGGCCCCCAGCCTAGAAGG + Intronic
1076348999 10:129801868-129801890 AGGTCTGCCCCAAGGCTGGAGGG + Intergenic
1077171605 11:1168792-1168814 GGGTGGGCTCCAAGCCCAGAAGG - Intronic
1077198399 11:1293058-1293080 CGGGGGGCTCCAGGCCTGGACGG + Intronic
1077239179 11:1501773-1501795 GGGCGGGAGGCAAGCCTGGAGGG - Intergenic
1077284623 11:1760127-1760149 GGGTGAACCCCAGGCTTGGAGGG + Intronic
1077379457 11:2222416-2222438 GGGAATGACCCAAGCCTGGAAGG + Intergenic
1077572590 11:3352837-3352859 GGCAGGGCCCAAAGACTGGAAGG + Intronic
1077901970 11:6497182-6497204 GGGCAGAGCCCAAGCCTGGAGGG - Intronic
1079028466 11:16967532-16967554 GGGTGGGCCCCAAGAATGGAGGG - Intronic
1081811211 11:45915105-45915127 GGATGGGCCCAAAGCCCTGAAGG + Intronic
1083617671 11:64034700-64034722 AGGTGGCCCCCAGGCCTCGATGG + Intronic
1083724004 11:64619016-64619038 GGGTGGGCCACGACCTTGGAAGG - Intronic
1083996864 11:66277151-66277173 GAGAGGCCCCCAATCCTGGATGG - Exonic
1084296494 11:68215890-68215912 GGCTGGGCCCACAGCCTGGCAGG + Intergenic
1085790289 11:79491948-79491970 GGGTGGGGCAGAAGCCTGGGGGG - Intergenic
1086914349 11:92511633-92511655 GGGTCAGCCCCCACCCTGGATGG + Intronic
1089287574 11:117417514-117417536 GGGTGGGCAGCACGCCTGGGAGG + Intergenic
1090326210 11:125888091-125888113 GGGACGGCCCCAGGGCTGGAGGG + Intronic
1091393125 12:138154-138176 GGGTGGGGCCCAGGAATGGACGG - Intronic
1091399932 12:175507-175529 GGGTTGGTCCCACCCCTGGAGGG + Exonic
1096233306 12:49909567-49909589 GGCTGGGCCCCAGGGCGGGAAGG - Intergenic
1096259792 12:50083330-50083352 GGTTGGGGCTCAGGCCTGGAAGG - Exonic
1096475406 12:51906612-51906634 GGGTGGGGGCCCTGCCTGGAAGG + Intergenic
1096615436 12:52830336-52830358 GAGTGGGTCCCATGCCTGAAAGG - Intronic
1096773550 12:53950998-53951020 AGGTGGGCCCCAACCCCTGAAGG + Intergenic
1097188699 12:57209364-57209386 GGGTGGGTCTCAGGCCTGCAGGG - Intronic
1101901258 12:108792660-108792682 GGGGGGGCCCTAAGCCGGGCTGG + Exonic
1102075572 12:110057205-110057227 GGATGGGCCCCATGCCAGCATGG + Exonic
1102294792 12:111728025-111728047 GGCTGGGCTCCAAGCCTGGCAGG - Exonic
1102927009 12:116833944-116833966 GAGGTGGCCCCAAGGCTGGAGGG + Intronic
1103466881 12:121149075-121149097 GGATGGGCCCCATGCCAGCATGG - Intronic
1103679874 12:122684952-122684974 GGGTGGGCCCTAATCCAGAATGG - Intergenic
1103930052 12:124445281-124445303 GGGTGGGGCCCATCCCTCGATGG + Intronic
1104926729 12:132317739-132317761 GGCTGGGCCCCGGGGCTGGAGGG - Intronic
1104971976 12:132534862-132534884 GGGTTGGACCCTGGCCTGGAGGG + Intronic
1104982622 12:132581015-132581037 TGCTGGGCCTCAGGCCTGGATGG - Intronic
1105542060 13:21324392-21324414 GGGAGGGCCCTGAGCCAGGATGG + Intergenic
1106031809 13:26011371-26011393 GGGTGGGCCCTAATCCAGCATGG - Intronic
1113509502 13:110841672-110841694 GGGTGGGCCCCTAGCCCGATAGG - Intergenic
1113702374 13:112396991-112397013 GGGTGGGCTACAGGCCTGTAAGG - Intronic
1113769036 13:112896982-112897004 GGGTGGGCTCTCAGCCTGCATGG - Intronic
1114322329 14:21557501-21557523 GGCTCAGCCCCAAGCCTGGAGGG + Intergenic
1114495897 14:23131846-23131868 GGGTGTTCCCAATGCCTGGAAGG + Intronic
1115755070 14:36521054-36521076 GTGTGGGCCCCGCGCCTTGAGGG + Intronic
1120307428 14:82788610-82788632 GAGTGGGCCCTAATCCTGAATGG + Intergenic
1121711916 14:96044827-96044849 GGGTGGGCCCTAAGCCAATATGG - Intronic
1124211792 15:27770294-27770316 GCGCGGACCCCAAGCCGGGAGGG + Intronic
1124706916 15:31974177-31974199 TGCTGAGCCCCTAGCCTGGAGGG + Intergenic
1125501250 15:40241413-40241435 GTGTGGCCCCCAGGCCTGGTGGG + Intronic
1125599140 15:40906245-40906267 GCTTTGGCCCTAAGCCTGGAGGG + Intergenic
1129169304 15:73798112-73798134 GGGAGGGGGCCAAGCCAGGAGGG - Intergenic
1129915580 15:79267050-79267072 GGGTGGAGCCCAAGCACGGATGG - Intergenic
1130656495 15:85795035-85795057 GGGTGGGCCCCAGGCCGCGCCGG + Intergenic
1132497609 16:271151-271173 GGGTGTGCTCCCAGCCTGGGGGG - Intronic
1132715042 16:1285960-1285982 GGATGGGCCCCAGGGCTGGGAGG - Intergenic
1134131936 16:11655977-11655999 GGGTGTGGGCCAGGCCTGGAAGG - Intergenic
1135834834 16:25815684-25815706 GGATGGGCCCCAAGCATGTGAGG + Intronic
1136267589 16:29130527-29130549 GGGAGGGGCCCAGGCCTGGGCGG - Intergenic
1136485806 16:30571184-30571206 GGGGGTGCCCTCAGCCTGGAGGG - Intronic
1137010659 16:35316832-35316854 AGGTGGGGCCCTAGCCTTGAGGG + Intergenic
1138030565 16:53556425-53556447 GGGGGCGCCCCAGGCCTGAAAGG - Intergenic
1139332111 16:66201420-66201442 GAGAGGGCCCCATTCCTGGAGGG - Intergenic
1139378867 16:66517703-66517725 GGCTGGGCCCCAACCCTTGGGGG - Intronic
1141614442 16:85202546-85202568 GGGTGAGCCCACAGCCTGGCTGG - Intergenic
1141786180 16:86202267-86202289 GGGTGAGCCCCCACCCTGGCAGG - Intergenic
1142049160 16:87946801-87946823 GGGTGGGATCCACGCCAGGAGGG + Intergenic
1142070891 16:88090871-88090893 GGGAGGGGCCCAGGCCTGGGCGG - Intronic
1142515830 17:428110-428132 GTGTGGTCCCCAAGCAAGGAAGG - Intergenic
1143410681 17:6706641-6706663 GGGTGGGGGCCAAGCCTGCACGG - Exonic
1143544031 17:7586071-7586093 GGGTGGGCCCCTCACCTGAATGG - Exonic
1145749249 17:27343419-27343441 TGCTGGGCCCCACTCCTGGATGG + Intergenic
1148047636 17:44753758-44753780 GGCTGGTCACCAGGCCTGGACGG + Intergenic
1149827216 17:59839966-59839988 GGGAGGACTCCAAGCCGGGAAGG + Exonic
1150470199 17:65430802-65430824 AGCTGGGATCCAAGCCTGGATGG + Intergenic
1150550450 17:66204694-66204716 GGGAGGGACACAAGCCTGGCTGG + Intergenic
1151242155 17:72766535-72766557 AGTAGGGCCCCAAGGCTGGAGGG - Intronic
1151297747 17:73197956-73197978 GGGTCCGCACCAAGCCTGGAAGG - Intronic
1151417125 17:73973844-73973866 GGGCGGGACCCAGGCCAGGATGG - Intergenic
1151640505 17:75389040-75389062 GCTGGGGCCCCAAGCCTGGATGG - Intronic
1151849769 17:76683489-76683511 GGGTGAGACCCAAGGCTGCAGGG + Intronic
1154198112 18:12280792-12280814 GGGTGGGCCTCCACCCAGGATGG + Intergenic
1154347209 18:13552031-13552053 GGGAGGGCACCAAGCCACGAGGG + Intronic
1157881455 18:51324870-51324892 AGGTGGCCCGCAAGCCTGGCAGG + Intergenic
1159798555 18:72869463-72869485 AGGTGACCCCCAAGTCTGGAAGG + Intergenic
1160005392 18:75064877-75064899 AGGTGCACCCCAAGCCAGGAGGG - Exonic
1160943163 19:1629480-1629502 GGGCGAGCCCCCAGCATGGAAGG + Intronic
1161286526 19:3471277-3471299 GGAGGGGCCCCCAGTCTGGAGGG - Intergenic
1161307577 19:3576473-3576495 GGGTGTGCCCCAAGCCTAGGAGG - Intronic
1161739250 19:6010300-6010322 GGGTGGGCCCAAAGACTGGGGGG + Intronic
1161766185 19:6210235-6210257 GGGTTGGGACCAAGCCTGGTGGG - Intergenic
1163699549 19:18780538-18780560 GGGAGGACCCCTAGCCAGGAGGG + Exonic
1163767359 19:19170969-19170991 GGCTGGGGTCCAATCCTGGAAGG - Intronic
1163907912 19:20163115-20163137 TGGTGGGACCCAATGCTGGAAGG + Intergenic
1163935001 19:20434594-20434616 TGGTGGGACCCAATGCTGGAAGG + Intergenic
1163949235 19:20568655-20568677 TGGTGGGACCCAATGCTGGAAGG + Intronic
1163968867 19:20773409-20773431 TGGTGGGACCCAATGCTGGAGGG - Intronic
1165758341 19:38307026-38307048 GGGTGGACCCCAAGCTTAGTTGG - Intronic
1165775367 19:38401258-38401280 GGGTGGACCAGGAGCCTGGAGGG - Intergenic
1165897363 19:39150834-39150856 GGGTGGGCAGCAGGCCTGAACGG - Intronic
1166356567 19:42230684-42230706 GGCTGGGCCCCTAGACTAGAGGG - Exonic
1166529820 19:43535424-43535446 CGGTGGGCCGCCAGCTTGGAAGG - Exonic
1166746010 19:45142210-45142232 CGGTGAGCCCCAAGCCCGGGAGG + Exonic
1166885847 19:45960655-45960677 GGCTGGCCCCCAAGCCCGGAGGG + Intronic
1167492869 19:49802100-49802122 GGGTGGGCCCCAGGCTGGGCTGG - Exonic
1167551301 19:50162874-50162896 GGGTCGGGGCCAGGCCTGGAGGG - Intronic
925195983 2:1926156-1926178 GGGTGGCCTCAAAGCCTGGCAGG + Intronic
926249773 2:11147952-11147974 AAGTGGGCACCAAGCCTGCAGGG + Intergenic
926306349 2:11639893-11639915 GGGGCTGCCCCAGGCCTGGATGG + Intronic
926706351 2:15840500-15840522 GGGTCTTCCCCAAGCTTGGAGGG - Intergenic
929061632 2:37930685-37930707 GAGAGGCCCCCAACCCTGGATGG + Intronic
929823658 2:45293022-45293044 GGGAGGGGCCCCAGACTGGAGGG - Intergenic
929860610 2:45674209-45674231 GGCTGGGCCCCAGGCTTGGAGGG - Intronic
930724242 2:54667081-54667103 GGGAGGTCCCCAGGCTTGGAAGG - Intronic
932605153 2:73160404-73160426 GGTTGGGCCCCATGCATGGAGGG + Intergenic
932616589 2:73235250-73235272 CCGTGGGTCCCAAGCCTCGATGG + Intronic
932768845 2:74489345-74489367 GGGAAGGCCCCAAGGCTGGAGGG + Intronic
933085097 2:78046045-78046067 GTGTAAGCCCCAAGCCTTGATGG + Intergenic
933692971 2:85194050-85194072 GGGTGGGGCAGAACCCTGGAAGG + Intronic
936397876 2:112142664-112142686 GGGTGGGCCACAACCCTGTCTGG + Intronic
938232077 2:129669710-129669732 GGGTGGGCCCCCAGCATCTAGGG + Intergenic
940849000 2:158670755-158670777 GGATGTGCCCCAGGCTTGGATGG + Intronic
941898284 2:170652864-170652886 GGTTGGGCTCCAACACTGGAGGG - Intronic
942616450 2:177796217-177796239 GCCTGGGCCCCAAGCTTTGAAGG + Intronic
946193715 2:218021261-218021283 GGGCAGGCCACAGGCCTGGAAGG + Intergenic
946660857 2:221997922-221997944 GTGTGGGCTACAAGCATGGATGG + Intergenic
947135770 2:226975446-226975468 GGGAGGGCCCCACTCCTAGAGGG + Intronic
948041135 2:234902522-234902544 GAGAGGGCCCCATGCCTGGCAGG + Intergenic
948742637 2:240057595-240057617 GGAGCGGCCCCAACCCTGGATGG + Intergenic
948797228 2:240411375-240411397 AGGTGGGCCCCCAGCATGGCAGG + Intergenic
948837382 2:240632208-240632230 AGGAGGGTCCCATGCCTGGAAGG + Intergenic
949053787 2:241912996-241913018 GTGTGGGCCCTGAGTCTGGAAGG + Intergenic
1170780827 20:19423890-19423912 GGTAGGCACCCAAGCCTGGAGGG + Intronic
1170852479 20:20017536-20017558 GGCCGGACCCCAAGCCCGGACGG + Intronic
1171446505 20:25207908-25207930 GGGTGGGCCTCAGGCCGGGGTGG + Intronic
1172606656 20:36218814-36218836 GGGTGGGCCCCCAGGATGGGCGG - Intronic
1172906941 20:38377425-38377447 TTATGAGCCCCAAGCCTGGAGGG + Intergenic
1173021083 20:39268754-39268776 GGGGAGGCCCCAAGCATGGCTGG - Intergenic
1174364565 20:50048643-50048665 GGGAGGGCCCCAAGGCTGAGGGG + Intergenic
1174581947 20:51578480-51578502 GGGTGGACCCCAGGCTTGGTTGG - Intergenic
1175013613 20:55764835-55764857 GTGTAAGCCCCAAGCCTTGATGG - Intergenic
1175573552 20:60042336-60042358 GGCCTGGCCCCCAGCCTGGAGGG + Intergenic
1175977507 20:62718519-62718541 GGGTGGGCCACAGGGCTGGAGGG - Intronic
1176246904 20:64101908-64101930 GGGTGGAACCCAGTCCTGGAGGG - Intergenic
1178053062 21:28768841-28768863 GGGTGGGCCCCAAACCTAATAGG + Intergenic
1178294488 21:31397643-31397665 GTGTTGGCACCAAGCCAGGAAGG - Intronic
1178487975 21:33030820-33030842 AGGAGGGCCCAAAGCCTGGCTGG - Intergenic
1179440295 21:41388630-41388652 GGATGGGCCCCACACCTGGTGGG + Intronic
1179639932 21:42740826-42740848 GAGTGGGCAGAAAGCCTGGAAGG + Intronic
1179994013 21:44965669-44965691 GGGTGAGCCCCAGGCATGCAAGG - Intronic
1180177837 21:46098739-46098761 TGGTGGGCTCCAGGCCGGGAGGG - Intronic
1180960854 22:19761598-19761620 GGGTGCGCCCCAAGCCGGGCCGG - Intronic
1181493034 22:23272738-23272760 GGGTGGGCCCCAATTCTGGAGGG - Intronic
1181496613 22:23290730-23290752 GTGTGGGGTCCAAGCCAGGAGGG + Intronic
1181725278 22:24806732-24806754 AGGTGTGCCCCACACCTGGAGGG - Intronic
1182146659 22:28000948-28000970 GGCTGGGCCCCAGGCAGGGAGGG - Intronic
1182356778 22:29725783-29725805 GAGAGGGCCCCTAGCCTGGATGG + Intronic
1182747614 22:32617578-32617600 GGGTGGGACCCAGGGCTGAAAGG + Intronic
1183069725 22:35387681-35387703 GGGTTTGCGCAAAGCCTGGAAGG + Intronic
1183432428 22:37773801-37773823 GGCTGGTCCTCCAGCCTGGAGGG - Exonic
1183662685 22:39230729-39230751 GCGTGGGGCCCAAGCCAGGGAGG + Intronic
1184090386 22:42290145-42290167 GGCTGGGCCCCAATCCTTGCTGG + Intronic
1184381345 22:44146813-44146835 GGTTGGGGCCCCAGCCTGGCTGG + Intronic
1184536479 22:45091096-45091118 GGTTGGGGCCCAAGCTTTGAAGG - Intergenic
1184867961 22:47213647-47213669 TCCTGTGCCCCAAGCCTGGAGGG - Intergenic
1185005932 22:48277030-48277052 GGGTGGGGACCAGTCCTGGATGG - Intergenic
1185138674 22:49088360-49088382 GGCTGGGCCCCGAGAGTGGACGG + Intergenic
1185234402 22:49703641-49703663 GGAGGGGCCACAGGCCTGGATGG + Intergenic
1185285821 22:49999605-49999627 GGGTGGGGCCTAGGCCTGGCCGG + Intronic
1185285840 22:49999645-49999667 GGGTGGGGCCCAGGCCTGGCCGG + Intronic
1185285860 22:49999685-49999707 GGGTGGGGCCTAGGCCTGGCCGG + Intronic
1185289815 22:50017660-50017682 GCCTGGGCCCCAACCCTGTATGG + Intronic
950800992 3:15551803-15551825 GGGAGGGACACAAGCCTGGCTGG - Intergenic
950965200 3:17141260-17141282 TGGTGTGCCCAGAGCCTGGAGGG + Intergenic
951019219 3:17764290-17764312 GTGTTGGCCCTATGCCTGGAAGG - Intronic
952058112 3:29473788-29473810 TGGTGGGCCCCACACTTGGAGGG - Intronic
952883882 3:38001326-38001348 GGGTGGGCCCCTGGCCTGCGTGG + Intronic
953606397 3:44415743-44415765 TAGTGAGCCCCAGGCCTGGATGG - Intergenic
954176435 3:48848979-48849001 GGGTGTGTGCCAAGCCTGTATGG - Intergenic
954298582 3:49687321-49687343 GGGAAGGCCCCAGGCCGGGACGG + Intronic
954449113 3:50562264-50562286 GTGTGGGCTCCCAGGCTGGAGGG - Intronic
954880330 3:53831347-53831369 GGGAAGGCCACAAGCCTGGCTGG + Intronic
954939962 3:54362691-54362713 GGGAGTGCACCATGCCTGGAAGG - Intronic
959792391 3:110378606-110378628 GGGTGGGCCCTAACCCAGTAAGG + Intergenic
964570655 3:158105364-158105386 GGATGGGCCCGCAGCCCGGATGG - Intronic
966748462 3:183300265-183300287 CTGTGTGCTCCAAGCCTGGAGGG + Intronic
968003561 3:195224291-195224313 GGGTGGGGCCCACACCTGGAGGG + Intronic
968607888 4:1544102-1544124 TTGTGGGACCCCAGCCTGGATGG - Intergenic
968705481 4:2075565-2075587 GCGTGGGCCACCAGCCTGGCAGG + Intronic
968917293 4:3502115-3502137 GGCTGGGCTCTCAGCCTGGAGGG + Intergenic
969029780 4:4202715-4202737 GGGTGGGCCCCCTGCCTGGCTGG + Intronic
969029941 4:4203851-4203873 GGGTGGGTCCCCTGCCTGGCTGG + Intronic
969719388 4:8885016-8885038 GGCTAGGCCCCCAGCCTGCAGGG - Intergenic
972672247 4:41224927-41224949 GGGTGGGCCCCAATCCAATATGG + Intergenic
973774367 4:54231210-54231232 GGGTGGGAGGCAAGCATGGATGG + Intronic
980197445 4:129608976-129608998 GGGTGTGGGCCATGCCTGGAAGG - Intergenic
983940631 4:173531446-173531468 GGCTTGGCCCCAAGCCGAGAGGG + Intergenic
986798096 5:11232003-11232025 GTGTGAGCCCCAAGCCTTGGTGG + Intronic
987631544 5:20478691-20478713 GGGTAGGACACAAGCCTGGCTGG + Intronic
990996965 5:61742268-61742290 GAGTGGACCTCAGGCCTGGATGG + Intronic
991377806 5:65984475-65984497 GGGTGGGCATGAAGCCTGGTGGG - Intronic
991408919 5:66327944-66327966 GGGTGAGCACCAAACCTGGCAGG - Intergenic
991971084 5:72142139-72142161 GGGTGGGCACCAAGCCCAGATGG - Intronic
992084424 5:73265195-73265217 GGGTTGGGGCCAAGCCAGGAGGG + Intergenic
992226934 5:74627876-74627898 GGTTGGGCCCCCAGCCTGTAGGG - Exonic
994006930 5:94848375-94848397 GGGTGACCCCCAAGGCTGTAGGG - Intronic
995846795 5:116502284-116502306 TTGTGGGCCACAAGCCAGGACGG - Exonic
998553670 5:143102249-143102271 GAGGGAGCCCCAGGCCTGGAAGG - Intronic
999273509 5:150312739-150312761 GTGCAGGCCCCAAGCTTGGATGG + Intronic
999807923 5:155101143-155101165 GGGTGGGCCCTAATCCATGACGG + Intergenic
1001653541 5:173331301-173331323 GGGAGGGCCCTAGGTCTGGAGGG - Intergenic
1001761787 5:174213795-174213817 GTCTGGGACCCAAGCCTGCAGGG - Intronic
1001772734 5:174308192-174308214 GAGTGGGACCCAAGGCTGTATGG - Intergenic
1002345834 5:178546995-178547017 GGATGCCCCCCAAGCTTGGAAGG - Intronic
1002454573 5:179338840-179338862 GGGTTGGCACCAGGCGTGGAGGG + Intronic
1002963228 6:1937160-1937182 GAGTGTTCCACAAGCCTGGATGG - Intronic
1003410076 6:5854399-5854421 GGGAGGGCCCTGAGCCAGGATGG - Intergenic
1004504373 6:16236071-16236093 CGCTGGTCCCCAAGCCAGGAGGG + Intergenic
1006295609 6:33168783-33168805 AGGTGGGCCCCCAACCTGGCTGG + Intronic
1007040901 6:38721413-38721435 GGGAGGGTCACAAGCCTGGGAGG + Intronic
1007254675 6:40520491-40520513 AGGTGGGACCCAAGTCTGCAAGG - Intronic
1007396497 6:41580971-41580993 TGGTGGGGTCCAGGCCTGGAAGG - Intronic
1007616504 6:43182649-43182671 GGATGGGGGGCAAGCCTGGATGG - Intronic
1010062093 6:71635222-71635244 GGGAGGGCCACAAGCCTGGCTGG - Intergenic
1011378651 6:86718966-86718988 GTGTGAGCCCCAAGCCTTGGTGG - Intergenic
1013175277 6:107671114-107671136 GGGCCGGCCCTGAGCCTGGACGG - Intergenic
1016457296 6:144244719-144244741 GAGTCGGACCCAAGCCTGGCTGG - Intergenic
1016992909 6:149942184-149942206 GGGCGGGGACCAAGCCTGGAGGG + Intronic
1017161710 6:151371619-151371641 GGTTGGGCTCCAAGCCTGTGGGG + Intronic
1018035091 6:159874953-159874975 GGGTGGGCCCTAATCCAGTATGG + Intergenic
1018175193 6:161172380-161172402 GTGTGTACCCCAGGCCTGGATGG - Intronic
1019235905 6:170612361-170612383 GGGTCGGGCCCAGGGCTGGAGGG - Intergenic
1019661691 7:2227798-2227820 GGGTGGGCACCCCGCCTGCAGGG + Intronic
1019748413 7:2713458-2713480 GGGCAGGCCCACAGCCTGGAAGG - Exonic
1020430987 7:8115964-8115986 GGGTGGTCCCCAAGTTTGGTTGG - Intronic
1020514971 7:9106783-9106805 GGGTGGGACCCAGTCCTGGCAGG + Intergenic
1021203425 7:17752462-17752484 GGGAAGGCCACAGGCCTGGATGG - Intergenic
1021804744 7:24343663-24343685 GAGAGGGCCCCAAGCCAGGAGGG - Intergenic
1021805323 7:24349332-24349354 GAGAGGGCCCCAGGCCAGGAGGG + Intergenic
1022469110 7:30671041-30671063 GGGTGGTCCTGAAGCCTGGCTGG + Intronic
1022470681 7:30680351-30680373 GGGGGGGCCCCCAGGCTGGTCGG + Intronic
1022500438 7:30879225-30879247 GGGTGGGTCCCAATCCAGTATGG + Intronic
1023461867 7:40406396-40406418 GTGTGGTCCCCAAGCAAGGATGG + Intronic
1024314698 7:48004624-48004646 GTGTGGGCAGAAAGCCTGGAAGG - Intronic
1024973237 7:55089791-55089813 TGGTGGTCTCCAAGCCTGGCTGG - Intronic
1027051621 7:75024846-75024868 GCGTGGGCCCCTGCCCTGGAGGG - Intergenic
1029276533 7:99408498-99408520 CGGTGGCCCGCAGGCCTGGAGGG - Intronic
1030124186 7:106139013-106139035 GGGTGGGTCCCAGGCATGGGTGG - Intergenic
1034067832 7:148153761-148153783 TGCTGGGCCCCCAGCCTGGGAGG + Intronic
1034281781 7:149859629-149859651 GATTGGGCACCAAGCCTGGCAGG + Intronic
1034304532 7:150038744-150038766 GGGGGGGTCCTAAGCCAGGAGGG + Intergenic
1034939006 7:155218460-155218482 GGGGTGGCCCCAGGCCTGGCAGG - Intergenic
1035167574 7:157000542-157000564 GAGTGCGCCCCAGGCTTGGAGGG - Intronic
1035515818 8:231894-231916 GGGTCGGGCCCAGGGCTGGAGGG - Intergenic
1036744262 8:11392927-11392949 GGGTGGGCGGCAGGGCTGGAGGG + Intronic
1037150238 8:15626964-15626986 GGGAGGGCCTGAAGCCTGGGGGG + Intronic
1037620192 8:20556727-20556749 GTGTGGTCCCCAAGCCTGCCTGG + Intergenic
1037820927 8:22134174-22134196 CGGAGGGCCCCAGGCCTAGAGGG + Intergenic
1037908507 8:22729406-22729428 GGGTGGGACCCAAGCCTGGGGGG - Intronic
1038270216 8:26068849-26068871 GGGTGGGCCCCAATCCAATATGG + Intergenic
1038409565 8:27347636-27347658 GGGTGGGCCCTAATCCAGTATGG - Intronic
1038690379 8:29756612-29756634 GGCTGGGCCCAAACCCTGGAAGG - Intergenic
1038940018 8:32294041-32294063 GGGTGTTCCCCCAGCATGGATGG - Intronic
1040855430 8:51944022-51944044 GGGTGGGCCCCAGGACCTGATGG - Intergenic
1040864830 8:52038364-52038386 GGGTGGGCCCTAATCCAGTATGG - Intergenic
1041045019 8:53880517-53880539 GGGTGGGCGGCAGGCATGGAGGG - Intronic
1043069161 8:75617206-75617228 AGGTGGGCCCCCAGCCTGTTGGG + Intergenic
1045172101 8:99682789-99682811 GGGAGGGACACAAGCCTGGCAGG - Intronic
1048187140 8:132251668-132251690 TGGTGGGAGCCAAGCCTGAAAGG - Intronic
1048539844 8:135332816-135332838 GGGTGGGCCAGAAGTATGGAGGG + Intergenic
1048880662 8:138869851-138869873 GGGTGGACCCGAAGGCTGGGAGG - Intronic
1049210065 8:141381909-141381931 GGCATGACCCCAAGCCTGGAAGG + Intergenic
1049219338 8:141421725-141421747 AGGTGGGCCCCAAGCCCCCAAGG - Exonic
1049296494 8:141843216-141843238 GGGTGACCCCCCAGCCTGGGAGG + Intergenic
1049468456 8:142764402-142764424 CGATGGGCCCCAGGCTTGGACGG + Exonic
1049540862 8:143208174-143208196 GCGTGGGCCCCCAGCCTTGGGGG - Intergenic
1049651257 8:143771075-143771097 GGGGGGGCCCCAGGCCTGGGAGG - Intergenic
1049674894 8:143885040-143885062 GGCTAGGCCCCAAGTCTGGGGGG - Intergenic
1049712857 8:144074129-144074151 TGTTGGGGCCCAAGCCGGGAAGG - Intergenic
1049777488 8:144413433-144413455 GGGTGGGGCCCAAGGCTTGGCGG - Intronic
1053379234 9:37635760-37635782 GAGAGGCCCCCAACCCTGGATGG + Intronic
1053895357 9:42736761-42736783 GGGTGGGGCTGAAGCCTGGGGGG + Intergenic
1055302024 9:74891958-74891980 GGGAGGGACCCAATCCTGGCAGG + Intergenic
1057198293 9:93127137-93127159 TGTTGGGCCCCAAGGCTGGGAGG - Intronic
1057357950 9:94347121-94347143 GGGCGGGCCTCAATACTGGAAGG + Intergenic
1058739017 9:107924009-107924031 GGGTGGGGCCCATGCAAGGATGG - Intergenic
1059308004 9:113369779-113369801 GAATGGGCTCCATGCCTGGATGG + Exonic
1059651564 9:116320352-116320374 AGCTGAGCCCCAAGGCTGGAGGG + Intronic
1060225287 9:121786570-121786592 GGGTGGGCCCCAGGAGTGGCTGG - Intergenic
1060400963 9:123349499-123349521 GGGTGGGGCCCGAGCGTGAATGG - Intergenic
1060722046 9:125986032-125986054 GGCAGGTCCCCGAGCCTGGATGG + Intergenic
1060883912 9:127137265-127137287 GAGTGGGCCACTAGTCTGGAGGG - Intronic
1061195213 9:129103592-129103614 GGGGCGGCCCCAAGCATTGAGGG - Intronic
1061968372 9:134029254-134029276 GGGTTGGCCCCAAGCATGGGAGG + Intergenic
1062394700 9:136348119-136348141 GGGTGAGCCCCGGGCCAGGAGGG + Intronic
1062551002 9:137086488-137086510 GGGTGGGCACCAGCCCAGGACGG + Intergenic
1062558836 9:137130114-137130136 GGGTGGCCCCCAGCCCAGGACGG - Intergenic
1185479807 X:437907-437929 GGGTGGGCGCCCAGCGTGGGGGG - Intergenic
1186075649 X:5875298-5875320 GTGTGTCCCACAAGCCTGGAAGG + Intronic
1189728784 X:43997070-43997092 GGGTGGGCCCTAATCCAGTATGG + Intergenic
1190474311 X:50812598-50812620 GTGTGGGCCCCAAGGCCTGAAGG + Intronic
1190567295 X:51743696-51743718 GGGTCGGCCCCGAGCGGGGATGG + Exonic
1190708323 X:53048639-53048661 GGGTGGTTCCCAGGCCAGGAGGG + Intergenic
1198747274 X:139903363-139903385 GGGTGGGACCCTTGCATGGAAGG - Intronic
1199894400 X:152117265-152117287 GGGTGGGGCCCAACCCTGCCAGG - Intergenic
1199947470 X:152680388-152680410 GGGTGGGGCCCAAGCCTGCCAGG + Intergenic
1199962209 X:152788066-152788088 GGGTGGGGCCCAAGCCTGCCGGG - Intergenic
1200018092 X:153180669-153180691 GGGTGGGACCCAGGCCTGCAAGG + Intronic