ID: 900213533

View in Genome Browser
Species Human (GRCh38)
Location 1:1468779-1468801
Sequence GGTGGCTGCCACGGCGGGGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 497
Summary {0: 1, 1: 0, 2: 4, 3: 48, 4: 444}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900213525_900213533 2 Left 900213525 1:1468754-1468776 CCACAGAGGGGTGGGCTTCACAG 0: 1
1: 2
2: 0
3: 32
4: 160
Right 900213533 1:1468779-1468801 GGTGGCTGCCACGGCGGGGCCGG 0: 1
1: 0
2: 4
3: 48
4: 444

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900213533 Original CRISPR GGTGGCTGCCACGGCGGGGC CGG Exonic
900119382 1:1041993-1042015 GGGGACGGCCACGGCGGGACAGG - Exonic
900186716 1:1336342-1336364 GGCTGCTGCCACGGCTGAGCTGG + Exonic
900213533 1:1468779-1468801 GGTGGCTGCCACGGCGGGGCCGG + Exonic
900216030 1:1482120-1482142 GGTGGCTGCCCCAGAGAGGCAGG - Exonic
900221093 1:1509595-1509617 GGTGCCTGCCACGGCAGGGCCGG + Intergenic
900223149 1:1520123-1520145 GGTGGCTGCCCCAGAGAGGCAGG - Exonic
900351094 1:2234988-2235010 GGTGACAGCCAGGGCAGGGCAGG - Intronic
900663088 1:3795833-3795855 GGGGGCTGCCCGGGCGGGGCGGG - Intronic
901086689 1:6615069-6615091 GGCGGCTGCCGCGGGAGGGCGGG + Intronic
901428621 1:9199015-9199037 GCTGGCTGCAAGGGCTGGGCTGG + Intergenic
902450013 1:16490988-16491010 GGTGGGTGCCAGGGTGGGGCAGG - Intergenic
902504450 1:16930207-16930229 GGTGGGTGCCAGTGTGGGGCAGG + Exonic
902823235 1:18956226-18956248 GGCGGCGGCGGCGGCGGGGCAGG - Exonic
902823244 1:18956244-18956266 GGGGGCTGCCCTGGCGGGGGCGG - Exonic
903260670 1:22130127-22130149 GGGGGCTGCCAGGGCAGGGAGGG - Intronic
903476017 1:23619640-23619662 GGTGGCGGCGTCGGCGCGGCGGG + Intronic
903497345 1:23778525-23778547 GGTCACAGCCACGGCGGGGGTGG + Exonic
903907452 1:26696647-26696669 GGTGGCGGCGGCGGCGGAGCCGG + Exonic
904492603 1:30870208-30870230 GGTGGCAACCAGGGCTGGGCAGG - Intronic
905422827 1:37859896-37859918 TGTGGCTGCCAGGGCGAGGGCGG - Intergenic
906156391 1:43616559-43616581 GGTGACTGGCAGGGCGGGGTTGG + Intronic
906356934 1:45115252-45115274 GGTGGCTGCCGGGCGGGGGCGGG + Intronic
906717929 1:47984199-47984221 CGTGGCTGCCCGGGCAGGGCTGG + Intronic
908555205 1:65250601-65250623 CGTAGCTGCCAGGGAGGGGCAGG - Intronic
909197899 1:72649627-72649649 AGTGGCTACTGCGGCGGGGCAGG - Intergenic
909433573 1:75616128-75616150 GGTGGCTGCTGCGGCGGCGGCGG + Intergenic
910787997 1:91021660-91021682 GGCGGCCGCCGCCGCGGGGCGGG - Intronic
911527529 1:99004733-99004755 GGTGGCTGCCTCGGCGGACCGGG - Exonic
911660807 1:100499323-100499345 GGTGGCAGCCTCGGCTGGGAAGG - Exonic
913219647 1:116649166-116649188 TGTGGCTGCCAAGACGGGGAGGG - Intronic
913422791 1:118691108-118691130 GGTGGTTGCCAGGGGTGGGCGGG - Intergenic
914197408 1:145454631-145454653 GGCGGCTGCGGCGGTGGGGCCGG - Intergenic
916233346 1:162561658-162561680 GGGGGCCGCGGCGGCGGGGCGGG - Exonic
916890257 1:169106614-169106636 GGCGGCGGCGGCGGCGGGGCGGG - Exonic
917285624 1:173419006-173419028 TGTGGCCCCCACGGTGGGGCTGG + Intergenic
918043735 1:180928520-180928542 CATGGCTGGCACGGAGGGGCCGG - Exonic
918188465 1:182148473-182148495 GGTGCCTGCCACTGAGGGGTAGG - Intergenic
919463239 1:197902935-197902957 CGGGGCGGCCGCGGCGGGGCGGG - Intronic
919732215 1:200920606-200920628 GGTGGCTTCCAAGCCAGGGCTGG - Intergenic
920528485 1:206685278-206685300 GGGGGCTGCGGCGGCGGGGCCGG - Exonic
922242078 1:223762103-223762125 GGTGGCTGCCATGGAAGGGCGGG + Intronic
922536268 1:226383091-226383113 CGTGGCCGCCACGGAGGCGCTGG + Exonic
922803787 1:228375605-228375627 GGTGGCTGCCAGGGTGAGGCAGG + Intronic
924628966 1:245719354-245719376 GGTGGTTCCCACGGTGGAGCAGG + Intergenic
1062951257 10:1505640-1505662 GGTGGCTGCCATGGTGGGGATGG - Intronic
1062951272 10:1505689-1505711 GGCGGCTGCCACGGTGGGGACGG - Intronic
1062951288 10:1505738-1505760 GGCGGCTGCCATGGTGGGGACGG - Intronic
1065197571 10:23281502-23281524 GGGGGCTGCTGTGGCGGGGCTGG + Intronic
1067565827 10:47336081-47336103 GGTGGCTGTCAGGGCGCGGAGGG + Intergenic
1067669682 10:48307204-48307226 GGAGGCAGCCAGGGCGCGGCGGG - Intronic
1069829985 10:71277186-71277208 GGCGGCTGTCACCCCGGGGCTGG + Intronic
1069921447 10:71818133-71818155 GGTGGCTGCCAGGCCAGGCCAGG + Intronic
1071166684 10:82815892-82815914 GCTGGCTGCTATGGCAGGGCAGG + Intronic
1071527453 10:86366607-86366629 GGTGGCGGCTGCGGCGGTGCTGG + Intergenic
1071527487 10:86366722-86366744 GGTGGCGGCGGCGGCCGGGCCGG + Intergenic
1072629128 10:97133486-97133508 GGTGGCTGCCAGGGACTGGCAGG + Intronic
1072926343 10:99620358-99620380 GGTGGCAGCGGCGGCGGGGGTGG - Exonic
1072938165 10:99732802-99732824 TGTAGCTGCCACGGCGGGGACGG + Intronic
1076354223 10:129840411-129840433 AGAGGCTGCCATGGTGGGGCTGG + Intronic
1076722095 10:132397180-132397202 GGCGGCGGCGGCGGCGGGGCGGG + Exonic
1077034617 11:488657-488679 GGGGGCTGCGAGGGCAGGGCCGG + Intronic
1077058939 11:609391-609413 GATGGCGGCCACGGCCAGGCTGG - Exonic
1077103953 11:833818-833840 TGTGTCTGCCACCGGGGGGCGGG - Intronic
1077134545 11:991941-991963 GGTGGCTGCCACGTGGGTGTGGG + Intronic
1077167327 11:1149707-1149729 GGTGGCCGCCAGGGCTGGGCAGG - Intergenic
1077215474 11:1393640-1393662 GGTGGCTGCCAGGGTGGAGAGGG + Intronic
1079361375 11:19773170-19773192 TGTGGCTGCCATAGCTGGGCAGG + Intronic
1081241670 11:40714105-40714127 TGTGGCTGGCAAGGTGGGGCTGG - Intronic
1081526936 11:43933896-43933918 AGCGGCTGCCATGGCAGGGCTGG - Intronic
1081982461 11:47276578-47276600 GGTGGCAGGCATGGTGGGGCAGG + Intronic
1083265763 11:61546209-61546231 AGTGGCCGCCGCGGCGGGGCTGG - Exonic
1083431048 11:62613593-62613615 GGTGGCTGGCACGGCTGGTGGGG + Exonic
1083894345 11:65612715-65612737 GGTGGGAGCCATGGCTGGGCAGG + Intronic
1084325096 11:68395699-68395721 GGTGGATGGCAGGGCGGGTCTGG - Intronic
1084393866 11:68896348-68896370 GGGGGCGCCCACGGCGGGGCTGG - Intronic
1084570392 11:69956300-69956322 GATGCCTGCATCGGCGGGGCAGG + Intergenic
1084643804 11:70442641-70442663 GGTGGCTGCCAGGGCCTGGCGGG + Intergenic
1086131936 11:83410037-83410059 AGTGGCTGACACAGCTGGGCTGG + Intergenic
1087014621 11:93543235-93543257 GGCGGCGGCGGCGGCGGGGCGGG - Intronic
1089242976 11:117097992-117098014 GGAGCCAGCCGCGGCGGGGCGGG - Intronic
1089262371 11:117232026-117232048 GGCGGCAGCTGCGGCGGGGCCGG - Exonic
1090069988 11:123535633-123535655 GGTGGCTGTCACTTCAGGGCTGG + Intronic
1094203653 12:27817909-27817931 GGTTGCTGCCAAGTTGGGGCTGG - Intergenic
1096372843 12:51083338-51083360 GGAGGCAGCTGCGGCGGGGCCGG - Exonic
1098105989 12:67069381-67069403 GGCGGCTGCCGCGGTGTGGCCGG + Intergenic
1099365243 12:81759368-81759390 GGTGGCTGCCAAGGAGGAGGAGG - Intronic
1099423650 12:82495839-82495861 GGTGGCTACCAGGGCTGGGCTGG + Intergenic
1101466955 12:104958453-104958475 GCTGTCTGCCAGGGCGCGGCCGG - Intronic
1101482118 12:105108035-105108057 GGTCCCAGCCACGGCGGGTCAGG + Intronic
1103077196 12:117993574-117993596 GGTGGCTGCCTCTGGGGAGCAGG - Intergenic
1103903681 12:124316427-124316449 CCTGGCTGCCACTGCGGAGCAGG + Intergenic
1104190749 12:126479946-126479968 TGTGGCTTCCAGGGAGGGGCAGG - Intergenic
1104759205 12:131287036-131287058 GGTGGAGGCCAGGGAGGGGCAGG - Intergenic
1104821406 12:131679460-131679482 GGTGGAGGCCAGGGAGGGGCAGG + Intergenic
1104841535 12:131828263-131828285 CGTCGCGGACACGGCGGGGCGGG + Intergenic
1104847258 12:131852749-131852771 TGAGGCTGCCAGGGCCGGGCAGG + Intergenic
1104862002 12:131928912-131928934 GGTGGGTGCCACTGAGGGTCTGG + Intergenic
1104903879 12:132203436-132203458 GGTCAATGCCACGGCAGGGCTGG - Intronic
1105012023 12:132762119-132762141 GGAGGCCACCAGGGCGGGGCCGG + Intergenic
1105828646 13:24144660-24144682 GGTGGCTGCTGCAGCGGGGCTGG - Intronic
1107086583 13:36432442-36432464 GGTGGCCGGCTGGGCGGGGCAGG - Exonic
1107605108 13:42048854-42048876 CGCCGCTGCCTCGGCGGGGCCGG + Exonic
1108240210 13:48456744-48456766 GCTGGCTGCTGCAGCGGGGCGGG + Intronic
1109426340 13:62169083-62169105 GCTGGCTGCCACAGCGGGGAGGG - Intergenic
1111230590 13:85340732-85340754 GGCGGCTGCCAGGCGGGGGCGGG + Intergenic
1112934521 13:104781574-104781596 GGTGGCTGGAATGGCGGGGTGGG + Intergenic
1113906688 13:113822541-113822563 GGAGGCCGCCACCGCAGGGCTGG - Intronic
1114522172 14:23346703-23346725 GGTGGCTGCCGCAGCAGGGAAGG + Exonic
1117842164 14:59870841-59870863 GGCAGCGGCCGCGGCGGGGCCGG - Exonic
1118339100 14:64879831-64879853 GGTGGCGGCGGCGGCGGCGCAGG + Exonic
1118768190 14:68924093-68924115 GGTGGTTGCCAGGGGAGGGCCGG + Intronic
1119779918 14:77270793-77270815 GGAGGCTGCCTCGGCGGGAAAGG - Intronic
1120168009 14:81220835-81220857 GGTGGCGGCAGCGGCGGCGCAGG - Exonic
1121027989 14:90630651-90630673 GGTGGTTGCCAGGGCTGGGAGGG - Intronic
1122082116 14:99273508-99273530 GGAGGCGGCCAGGGCGGGTCGGG + Intergenic
1122123996 14:99569435-99569457 GGTGGGTGCCTCTGTGGGGCAGG - Intronic
1122130723 14:99603442-99603464 GGTGGCGGCGGCGGCGGGGGCGG - Exonic
1122221083 14:100239410-100239432 GGTGGCGACCACGGCGGCGGGGG + Exonic
1122603543 14:102932882-102932904 GGGGGCGGGCAGGGCGGGGCGGG + Exonic
1122884917 14:104706657-104706679 TTTGGCTGCCACGGCTGGGCAGG + Intronic
1122888234 14:104720081-104720103 AGTGGCTGCCAGGGCTGGGGAGG - Intronic
1122961080 14:105093824-105093846 GGTGGCTGCCGCGGCGATGTGGG + Intergenic
1123016416 14:105377696-105377718 TGGGGCTGCCAGGCCGGGGCAGG - Intronic
1123039781 14:105485775-105485797 GGTGGCAGACAGGGCAGGGCAGG + Intergenic
1123068905 14:105631545-105631567 GATGGAGGCCTCGGCGGGGCTGG + Intergenic
1123107240 14:105847671-105847693 GGTGGCTGCCAGGCCCGGCCTGG - Intergenic
1123109895 14:105861468-105861490 GGTGGCTGCCAGGCCCGGCCTGG - Intergenic
1123110367 14:105864318-105864340 GCTGGCTGCCACGGCCGGCCCGG - Intergenic
1124132542 15:27003831-27003853 GGTGGCTGGCCGGGCGGGGGGGG + Intronic
1124249548 15:28097809-28097831 TGTGGTTGCCAGGCCGGGGCAGG - Intronic
1124415413 15:29469557-29469579 GGTGGTTGCCATGGCGGGGGAGG + Intronic
1125761281 15:42097236-42097258 GCTGGCAGGCACAGCGGGGCTGG + Intergenic
1126767009 15:52019458-52019480 GGCGGCGGCGACGGCGGAGCCGG + Intronic
1127565544 15:60184641-60184663 GGTGGATGCCACAGCAGGGAGGG + Intergenic
1128847977 15:70918142-70918164 GCTGGCTGCTACAGCAGGGCAGG - Intronic
1129853732 15:78810457-78810479 GGAGGCCGGCCCGGCGGGGCGGG + Intronic
1130648679 15:85749999-85750021 GGTGACTGTCAGGGAGGGGCGGG - Intergenic
1131046668 15:89320975-89320997 GGTGGATGACACTGCAGGGCAGG - Exonic
1131134706 15:89925017-89925039 GGTGGCTGCCTCTGGGGGACTGG + Intergenic
1131157425 15:90083850-90083872 AGGGGCTGCCACGGCAGGGAAGG - Exonic
1132501007 16:284686-284708 AGTGGCTGCGACGGCGGGTGGGG + Exonic
1132558454 16:582924-582946 GGTGGCAGCCACAGCTGGGGAGG - Exonic
1132749788 16:1452226-1452248 AGTGGGTGCCACGGCGGGAGTGG - Intronic
1133013613 16:2928876-2928898 TGTGGCTGCCTCGGCTGGTCGGG - Intronic
1134521872 16:14922521-14922543 GGTGGCCACCAGGGCAGGGCAGG - Intronic
1134551550 16:15141147-15141169 GGAGGCTGGCAGGGCTGGGCGGG - Intergenic
1134709542 16:16321172-16321194 GGTGGCCACCAGGGCAGGGCAGG - Intergenic
1134716755 16:16361201-16361223 GGTGGCCACCAGGGCAGGGCAGG - Intergenic
1134950061 16:18347473-18347495 GGTGGCCACCAGGGCAGGGCAGG + Intergenic
1134957997 16:18390958-18390980 GGTGGCCACCAGGGCAGGGCAGG + Intergenic
1136611966 16:31371806-31371828 GGTGGCGGCCGCGCTGGGGCTGG + Intronic
1138390674 16:56668124-56668146 GCTGGGTGCAAGGGCGGGGCGGG - Intronic
1138486799 16:57350549-57350571 GGTGGCTGCCAGGGTGGGTCTGG - Intergenic
1138507747 16:57486538-57486560 GCCGGCCGCCAGGGCGGGGCAGG - Intronic
1138579437 16:57930841-57930863 GGTGGCTGCCGGGGCTGGGGTGG + Intronic
1138619101 16:58197773-58197795 GGTGGCGGCGGCGGCGCGGCGGG + Exonic
1139475078 16:67199065-67199087 CGGGGCCGCCTCGGCGGGGCGGG + Intergenic
1139637082 16:68264391-68264413 CGTGGCCGCCACGGCCTGGCCGG - Intergenic
1139657180 16:68396134-68396156 GGTGACAGCCACGGAGGGGTTGG - Intronic
1139956891 16:70697481-70697503 GGTGGCTGCGAGGGCCTGGCTGG + Intronic
1140857872 16:78993676-78993698 TGTGGCTGCCACGGGGGGACAGG + Intronic
1140927858 16:79600239-79600261 GGTGGCTGCGGCGGCGAAGCTGG + Exonic
1141493413 16:84390231-84390253 GGAGGGCGCCACAGCGGGGCTGG + Intronic
1141768950 16:86077152-86077174 GGTGGCTGCTACTTTGGGGCAGG - Intergenic
1141831655 16:86512564-86512586 GGTGGCTGCCCTGGCGGTGACGG + Intronic
1141951618 16:87343576-87343598 GGTGTGTGCAGCGGCGGGGCTGG - Exonic
1142193951 16:88730959-88730981 GCTGGGTGCCACTGTGGGGCAGG + Intronic
1142719549 17:1767031-1767053 GCTGCCTGCCAAGGAGGGGCGGG - Intronic
1142799861 17:2338029-2338051 GGTGGCGGCGATGGCGGGGATGG + Intronic
1143007459 17:3846166-3846188 GGCGGAGGCCCCGGCGGGGCCGG - Exonic
1143485387 17:7251347-7251369 GGGGGCTGCCCCCGGGGGGCTGG - Exonic
1143791327 17:9298324-9298346 TGTGGGTGCCAGGGCTGGGCTGG - Intronic
1144061158 17:11583933-11583955 GGGGGCTGCCATGATGGGGCTGG - Intergenic
1144626349 17:16846191-16846213 GGTGGCTGCCTGGGAGGGCCTGG - Intergenic
1144767005 17:17738378-17738400 GGCGGCTGGCCTGGCGGGGCGGG + Intronic
1144770645 17:17757573-17757595 GGCGGCAGCCACGGCTGGGCAGG - Intronic
1144849500 17:18236918-18236940 GGTGGCTGGCACTGCAGGCCAGG + Exonic
1144880083 17:18426528-18426550 GGTGGCTGCCTGGGAGGGCCTGG + Intergenic
1145152150 17:20517856-20517878 GGTGGCTGCCTGGGAGGGCCTGG - Intergenic
1145778033 17:27543211-27543233 GGAGGCTGCCACAGTGGAGCTGG - Intronic
1146339606 17:32007670-32007692 GGCGGCGGCGGCGGCGGGGCCGG - Intergenic
1146656407 17:34637586-34637608 TGTGGGTGGCACGACGGGGCTGG - Exonic
1147184245 17:38705182-38705204 CATGGCTGCCGCGGCCGGGCAGG + Intergenic
1147580495 17:41624889-41624911 GGTGGCTGCCTGGGAGGGCCTGG - Intergenic
1147885286 17:43680129-43680151 GGTGGCTGCCACCGACTGGCTGG - Intergenic
1147895056 17:43745158-43745180 GGTGGGAGCCAGGGCTGGGCTGG + Intergenic
1148551066 17:48551097-48551119 GGTGGCGGCGGCGGCGGGGGAGG - Exonic
1148557365 17:48586444-48586466 GGTGGCTGCGGCGGTGTGGCCGG + Intronic
1148852546 17:50561831-50561853 GGGGGCTGCCAGGGAGGGGAGGG + Intronic
1149682833 17:58517737-58517759 GGTGGGGGCCAGGGCGGAGCCGG + Intronic
1149997062 17:61411049-61411071 GGTGCCTGCGAAGGCCGGGCGGG + Intergenic
1150407977 17:64919173-64919195 GGCGGCGGCGGCGGCGGGGCCGG + Intronic
1150791892 17:68205756-68205778 GGCGGCGGCGGCGGCGGGGCCGG - Intergenic
1151427687 17:74041685-74041707 GCTGGCTTCCAGGGCTGGGCAGG - Intergenic
1151670489 17:75569304-75569326 TGTGGCAGGCACGGCAGGGCAGG + Exonic
1151821469 17:76499356-76499378 GGTGGCTGGCACGGTGGGAGAGG - Intronic
1152049182 17:77959080-77959102 GGCGGCTGCGGCGGCGGCGCGGG - Intergenic
1152320833 17:79608255-79608277 GTTGGGAGCCACAGCGGGGCTGG - Intergenic
1152343775 17:79739358-79739380 AGTGGCTCCCACTGCTGGGCCGG + Intronic
1152354190 17:79798711-79798733 GGAGTCTGACACGGAGGGGCAGG + Intronic
1152433111 17:80260522-80260544 GGCGGCGGGCAGGGCGGGGCCGG + Intergenic
1152433124 17:80260552-80260574 GGCGGCGGGCAGGGCGGGGCCGG + Intergenic
1152433137 17:80260582-80260604 GGCGGCGGGCAGGGCGGGGCCGG + Intergenic
1152433150 17:80260612-80260634 GGCGGCGGGCAGGGCGGGGCCGG + Intergenic
1152433163 17:80260642-80260664 GGCGGCGGGCAGGGCGGGGCCGG + Intergenic
1152433176 17:80260672-80260694 GGCGGCGGGCAGGGCGGGGCCGG + Intergenic
1152433189 17:80260702-80260724 GGCGGCGGGCAGGGCGGGGCCGG + Intergenic
1152433202 17:80260732-80260754 GGCGGCGGGCAGGGCGGGGCCGG + Intergenic
1152433215 17:80260762-80260784 GGCGGCGGGCAGGGCGGGGCCGG + Intergenic
1152433228 17:80260792-80260814 GGCGGCGGGCAGGGCGGGGCCGG + Intergenic
1152449292 17:80366157-80366179 GCTGGCTCCCTCGGCCGGGCAGG + Intronic
1152584157 17:81181701-81181723 GCTGGCGGCCACGGAGGGGTGGG + Intergenic
1152644101 17:81460924-81460946 AGGGGCTGCCACGGCGGCCCAGG - Exonic
1153506349 18:5803435-5803457 GGAAGCTGCCACGGCTTGGCAGG - Intergenic
1153522159 18:5963441-5963463 GGTGGAGGCCACCACGGGGCAGG - Intronic
1153900571 18:9614387-9614409 AGTGGCTGCCGGGCCGGGGCCGG - Intronic
1154115233 18:11608715-11608737 GGTGGCTGGCCAGGCGGGGGAGG - Intergenic
1155508123 18:26550445-26550467 GGTGGCGTCCAGGGCCGGGCAGG - Intronic
1156275569 18:35580968-35580990 GGTGCCTGCCCCGGCGGTGCGGG + Intergenic
1156987035 18:43360826-43360848 GGTGGCAGCCACAACGGGACAGG + Intergenic
1157383939 18:47247085-47247107 GGCGGCGGCGGCGGCGGGGCCGG + Intronic
1158544900 18:58387931-58387953 TTTGGCTGCCACGGTGGGGGTGG - Intronic
1158976822 18:62716859-62716881 GGTGGCCGGGACGGCGGGGCTGG - Exonic
1159941395 18:74411689-74411711 GGTGGATGCCAGGGCGGGGAGGG - Intergenic
1160060108 18:75522047-75522069 GGTGGCTGCTGCGTCAGGGCAGG - Intergenic
1160242129 18:77132071-77132093 GCTGGCTGCCAGGGCGGGCTGGG - Intronic
1160497679 18:79384661-79384683 GGTGGCGGCCAGGGCTGGGAGGG + Intergenic
1160517481 18:79486586-79486608 GGTGGCTGCCCGGGCGAGCCGGG - Exonic
1160680327 19:409171-409193 GGCGGCGGCGGCGGCGGGGCTGG - Intergenic
1160696915 19:489325-489347 GCGGGCTGCGACGGCGGGTCGGG - Intronic
1160818656 19:1047800-1047822 GGTGGCTGCATTGGAGGGGCGGG + Intronic
1160833140 19:1112578-1112600 GGTGGCGGCAACGCTGGGGCGGG - Intronic
1160860885 19:1236859-1236881 GGCGGCGGCCTCGGGGGGGCGGG + Intronic
1161205916 19:3041464-3041486 GGTGGCTCTCAGGGAGGGGCGGG - Intronic
1161215743 19:3094406-3094428 GGTGGCTGCGGCGGCGGCGCGGG + Exonic
1161215770 19:3094493-3094515 GGCGGCGGCCGAGGCGGGGCGGG + Exonic
1161450701 19:4343854-4343876 GGAGGCGGCGGCGGCGGGGCCGG + Exonic
1161671348 19:5612809-5612831 GGTGGGTGGCATGGCAGGGCAGG - Intronic
1161741042 19:6021456-6021478 GGTCGCCGCCACGGAGGGACTGG + Intronic
1161815215 19:6495661-6495683 GCTGGCTGCCCCGGCTGGTCAGG + Exonic
1161851408 19:6739732-6739754 GGTGGCTGCGGCGGCGGCGGCGG + Exonic
1162535839 19:11262474-11262496 GGCGGCGGCGGCGGCGGGGCCGG - Intronic
1162744284 19:12790159-12790181 GGAGGCTGCCGCGGCTGGGCGGG + Intronic
1162934161 19:13972876-13972898 GGTGGCGGCGGCGGCGGGGGAGG - Exonic
1162954334 19:14090074-14090096 TGTGGCGGCGCCGGCGGGGCCGG + Exonic
1163154486 19:15432520-15432542 GGTGGCGGCGGCGGCGGGGGTGG + Intronic
1163827644 19:19532628-19532650 GGCGGCTGCCTCCGCGGTGCTGG - Exonic
1164157576 19:22605849-22605871 GGTGGCTGTCACCACGTGGCTGG - Intergenic
1164558290 19:29269937-29269959 GCTGGCAGCCACAGCGGGGGGGG - Intergenic
1164949645 19:32326462-32326484 GGGGGCTGCCACTGGGGGACAGG + Intergenic
1165406404 19:35633758-35633780 GGTGGCGGCGGCGGCTGGGCTGG + Exonic
1165845670 19:38816381-38816403 GGCGGCTGCCACCCCGGGGCTGG + Intronic
1166078126 19:40425717-40425739 GCTGTCTGCCCCGGCCGGGCCGG - Intronic
1167116767 19:47493075-47493097 GGTGGCGGTCCCTGCGGGGCTGG + Intronic
1167369653 19:49072830-49072852 GGCGGCGGCGGCGGCGGGGCAGG - Exonic
1168145700 19:54419139-54419161 GGTGGCGGCCTTGGCGGGCCTGG + Exonic
1168630051 19:57949504-57949526 GCTGGCTGCTGCGGCGGGGCGGG + Intergenic
926724171 2:15984530-15984552 GGCAGCTCCCACGGCCGGGCAGG - Intergenic
927811997 2:26185369-26185391 GGTGTCTTCCTCGGCGGGGTGGG + Intronic
927935021 2:27071548-27071570 GGCCACGGCCACGGCGGGGCTGG + Intronic
928593920 2:32842913-32842935 GGTGGGTGGCGGGGCGGGGCAGG - Intergenic
929556899 2:42931264-42931286 GGTGGAAGTCACTGCGGGGCAGG + Intergenic
929830417 2:45342625-45342647 GGTGCCTGACACAGCTGGGCTGG + Intergenic
930096440 2:47570286-47570308 GGCGGCGGCTACGGCGGGGCGGG + Exonic
930728777 2:54708781-54708803 GGGGGCTGCCAAGACGTGGCGGG - Intergenic
932567227 2:72917695-72917717 GGCGGCTGCTGCGGCGGAGCGGG - Exonic
932661548 2:73657534-73657556 AGTGGTTGCCAGGGCGAGGCGGG - Intergenic
932735639 2:74252269-74252291 GGTGGCAGTGGCGGCGGGGCTGG - Exonic
935347243 2:102119949-102119971 GGTGGCTGCCAAGGAGGGAAGGG - Intronic
936390778 2:112071303-112071325 GGTGGCGGCGGCGGGGGGGCGGG - Intronic
936600450 2:113890043-113890065 GGAGGAGGCCGCGGCGGGGCAGG + Exonic
937863530 2:126731542-126731564 GGGGGCTGCCTCGGTGGGGAGGG + Intergenic
938280596 2:130061129-130061151 GGTGGCAGCCAAGGCAGGACAGG + Intergenic
938332083 2:130455035-130455057 GGTGGCAGCCAAGGCAGGACAGG + Intergenic
938357727 2:130665633-130665655 GGTGGCAGCCAAGGCAGGACAGG - Intergenic
938358234 2:130668652-130668674 GGTGGCAGCCAAGGCAGGACAGG - Intergenic
939168967 2:138671620-138671642 GGTGCATGCCACGGAGGGGCTGG - Exonic
940076362 2:149746598-149746620 GGTTGCTGCCACCGAGGGACTGG - Intergenic
941095970 2:161239330-161239352 GGTGGCGGCCACGCTCGGGCAGG - Intergenic
942278079 2:174336894-174336916 GGCGGCTGCCACGGCGGCGCTGG - Exonic
942450916 2:176107623-176107645 GGGGGCGGCCCCGGCGGGGGCGG + Exonic
942678160 2:178450569-178450591 AGTGACTGCCGCAGCGGGGCCGG - Intronic
945035006 2:205697098-205697120 GCTGGCTGCCTGGGCTGGGCTGG + Intronic
945102502 2:206274946-206274968 GGTGAGTGCCGCGGCGGGGGCGG + Exonic
945404038 2:209423915-209423937 GTGGGCGGCCGCGGCGGGGCTGG - Intergenic
946865658 2:224039289-224039311 GCTGGCTGCCGCGGCGGCGGGGG + Intronic
947447892 2:230178683-230178705 GGTGGCTGGCACTGAGGGGATGG + Intronic
947742402 2:232490698-232490720 TGTGGCGGCCACGGCGGCTCCGG - Intergenic
947992257 2:234497054-234497076 GGCGGCTGCTGCGGCGGCGCGGG - Intergenic
948492143 2:238320562-238320584 GGCGGCGGCGGCGGCGGGGCCGG + Exonic
948698862 2:239748278-239748300 GGTGGCTGCATCTGCAGGGCAGG - Intergenic
1168910608 20:1443857-1443879 GGTGGCAGCCATGGCTGGCCGGG + Exonic
1169187627 20:3632062-3632084 GCTGGCTGCCAGGTCTGGGCTGG - Intronic
1171035412 20:21709327-21709349 GCAGGCGGCCACGGCGGGCCCGG - Exonic
1171173452 20:23034974-23034996 GGGGTCTGCGGCGGCGGGGCTGG - Intergenic
1171249500 20:23637566-23637588 GGAGGCTGGGACGGCGGGGCCGG + Intronic
1171256196 20:23690651-23690673 GGGGGCTGCCAGGGTGGGGCGGG - Intergenic
1171997044 20:31739488-31739510 GGTCGCCGCCTAGGCGGGGCAGG + Exonic
1172870804 20:38134478-38134500 GGTGGAGGCCAGGGCAGGGCTGG + Intronic
1173672914 20:44810418-44810440 GCTGGCGGGCGCGGCGGGGCCGG + Intergenic
1173821235 20:46021905-46021927 GGGGCCTGCCAGGGCCGGGCGGG + Intronic
1174178242 20:48658281-48658303 TGTGGGGGCCACGGTGGGGCTGG - Intronic
1174181743 20:48679486-48679508 GATGGCTTCCAGGACGGGGCAGG + Intronic
1174287022 20:49481072-49481094 GGTGGGAGCCAAGGCAGGGCAGG - Intronic
1175191120 20:57212797-57212819 GCTGGCTGCCAGGGTGGGGCCGG - Intronic
1175381558 20:58567612-58567634 GGTGGCATCCATGGCGGGGAAGG + Intergenic
1175992298 20:62795687-62795709 TGTGGCGGTCTCGGCGGGGCAGG + Intergenic
1176130505 20:63494779-63494801 AGTGGCGGCTAGGGCGGGGCGGG - Intronic
1178937539 21:36876060-36876082 AGTGGCTGCTGCGGTGGGGCAGG - Intronic
1179719576 21:43307507-43307529 CGTGGCTGCCAGGGTGGGGCAGG + Intergenic
1179873261 21:44254418-44254440 GGTGGCTGGGCCGGCGGGGTTGG + Intronic
1180178195 21:46100565-46100587 GGTGGCTGCCAGGGGAGGGAAGG - Intronic
1180188914 21:46153576-46153598 GGTGGCGGCAAAGGCGGGGGAGG - Intronic
1180211086 21:46295816-46295838 GGTGGGTGCCACGGGGTGGTGGG - Intronic
1180820939 22:18827224-18827246 TGTGGCTGCCAAGACGGGGAGGG - Intergenic
1181026822 22:20131725-20131747 GCTGGGGGCCGCGGCGGGGCGGG - Intronic
1181192038 22:21148821-21148843 TGTGGCTGCCAAGACGGGGAGGG + Intergenic
1181207159 22:21261689-21261711 TGTGGCTGCCAAGACGGGGAGGG - Intergenic
1182473333 22:30561787-30561809 GGTGGCTGGCACGGGAGGGACGG - Intronic
1182546776 22:31081250-31081272 GTTGGCTGGCGCGTCGGGGCAGG + Intronic
1182858484 22:33538672-33538694 GGTGGCTGCCACGTGGTGGGGGG - Intronic
1183595511 22:38807797-38807819 GGTGGCTGGCCGGGCGGGGAGGG - Intergenic
1184146511 22:42614632-42614654 GGTCGGGGCCACGGCGGGGACGG + Intronic
1184262139 22:43324438-43324460 GCTGGCTGCCACAGCAGGCCTGG - Intronic
1184493720 22:44825418-44825440 GCTGGCAGCCACGGAGGCGCTGG - Intronic
1184827682 22:46964061-46964083 GCTGGCAGCCAAGGAGGGGCAGG - Intronic
1185258301 22:49848663-49848685 GGTGGATCCGGCGGCGGGGCTGG + Intergenic
1185270704 22:49928304-49928326 TGTGGCTGCCTCTGCGGGCCGGG - Intergenic
1203219761 22_KI270731v1_random:33727-33749 TGTGGCTGCCAAGACGGGGAGGG + Intergenic
1203271066 22_KI270734v1_random:53100-53122 TGTGGCTGCCAAGACGGGGAGGG - Intergenic
950066444 3:10115692-10115714 GGCGGCGGCCATGGCGGGACAGG + Exonic
950092070 3:10303011-10303033 GGTGGCTGCCAGGGCTGGGGAGG + Intronic
950483576 3:13259710-13259732 GGAGGCTCCCACGGGAGGGCAGG - Intergenic
951543926 3:23806899-23806921 GCGGGGCGCCACGGCGGGGCAGG - Intronic
952040381 3:29254379-29254401 GTTGCCTGCCACCGCAGGGCTGG - Intergenic
953333901 3:42077935-42077957 GGTGGCTGCCAGGCCTGGGATGG - Intronic
954442695 3:50530466-50530488 GCCGGCTGCTGCGGCGGGGCCGG + Intergenic
954649844 3:52154361-52154383 GGGCGCAGCCATGGCGGGGCTGG + Exonic
955387631 3:58492136-58492158 GGCGGCTGCTGCGGCCGGGCCGG - Intronic
956677994 3:71753580-71753602 GCGGGATGCCTCGGCGGGGCTGG + Intronic
958141662 3:89570643-89570665 GAAGGCTGCTATGGCGGGGCAGG + Intergenic
961378463 3:126482272-126482294 GGTGTGTGCCATGGCTGGGCAGG + Exonic
961387390 3:126530186-126530208 GGTGGCAGGCAGGGTGGGGCTGG + Intronic
961735878 3:129001901-129001923 GGGGGCCACCACGGCCGGGCAGG + Exonic
961823919 3:129588884-129588906 GGTGGCTGGCAGGGCTGGGGAGG + Intronic
962277953 3:134030033-134030055 GGCGGCGGCGGCGGCGGGGCGGG - Exonic
962758987 3:138491968-138491990 GGTGGTGGCCATGGTGGGGCAGG - Intergenic
964398324 3:156272106-156272128 GGTGGTAGCCACGGGGGTGCTGG - Intronic
967916722 3:194583900-194583922 GGCGGCTGCGGCGGCGGGGCGGG + Intergenic
968213397 3:196868018-196868040 GGCTGCTGCCGCGACGGGGCCGG + Exonic
968524236 4:1047879-1047901 GGTGGCTGCCAAGGAAGGCCAGG + Intergenic
968627104 4:1630735-1630757 GGAGGCTGCCAGGGCAGGGCAGG + Intronic
968674931 4:1871931-1871953 GGCGGCCGCCTCGGCCGGGCCGG - Intronic
968815157 4:2818196-2818218 GGCGGCTGCCAGGCCAGGGCCGG + Exonic
968874057 4:3255973-3255995 GGCGGCGGCGGCGGCGGGGCCGG + Exonic
968957801 4:3728063-3728085 GGTGGCCCCCACGGTGGGGAGGG - Intergenic
973279220 4:48341716-48341738 GGCGGCGGCGGCGGCGGGGCCGG + Exonic
973613595 4:52659012-52659034 GGTGGCTGGGGCGGCGGGGGCGG - Intronic
976398625 4:84583371-84583393 GGAGGCCGCCACGGCAGCGCGGG + Exonic
977176843 4:93829017-93829039 GGTGGCTGCGGCGGCGGCGGCGG - Exonic
977359206 4:95981878-95981900 GCTGGCTGCTACAGTGGGGCAGG - Intergenic
980007444 4:127558804-127558826 GGTAGCTGCCACAATGGGGCTGG + Intergenic
985025768 4:185737657-185737679 GGCGGCTGCCTCTGCGGGGATGG + Intronic
985034021 4:185820480-185820502 AGGGGCTGCCAGGGCAGGGCTGG + Intronic
985497725 5:218809-218831 GGTGGCCGCCCTGGCTGGGCTGG + Intronic
985573550 5:663428-663450 GGCAGCTTCCACGGCAGGGCTGG - Exonic
985688371 5:1294037-1294059 GGTGGCTTCTTCGGCGGGTCTGG + Exonic
985813949 5:2112313-2112335 GGCGGCTGCCTGAGCGGGGCCGG - Intergenic
986206188 5:5627459-5627481 GGCTGCAGCCACGGAGGGGCAGG + Intergenic
987050471 5:14143769-14143791 GCTGGCCGCCGCGGCGGGGCCGG - Exonic
988081056 5:26416141-26416163 AGTGGCTGCTTCGGCCGGGCAGG + Intergenic
988982394 5:36584566-36584588 GGTGGCTGCCCAGGCAGTGCAGG - Intergenic
991230979 5:64331997-64332019 GCTGGCTGCTGTGGCGGGGCAGG - Intronic
992269639 5:75052502-75052524 GGTGCCTACCACAGCGGGTCGGG - Intergenic
996308432 5:122077268-122077290 CGTGGCTGCCTGGGCGCGGCGGG - Intronic
996404263 5:123090471-123090493 GGTGGCGGCGGCGGCGGGGAGGG + Exonic
997450372 5:133977761-133977783 AGTGGCTGCCACTGCGGAGCTGG + Intronic
997976686 5:138445332-138445354 GGAGGCTGCCAGGGCTGGGTCGG - Exonic
998157746 5:139796015-139796037 GCTGGCGGCCAGGCCGGGGCGGG + Intronic
1001419189 5:171573929-171573951 GCTGGCGGCCAGGTCGGGGCGGG + Intergenic
1001826676 5:174751174-174751196 GGGCGCTGCCAGGGCGGGGTCGG - Intergenic
1002029364 5:176416527-176416549 GCTGGCTGTCACTGCGGTGCGGG + Exonic
1002314798 5:178336559-178336581 GGTGGTTGCCACGCAGAGGCCGG + Intronic
1002784481 6:391558-391580 GGGGGCTGCCGCGGCCGGGGTGG - Intergenic
1002788878 6:424302-424324 GGGGGCTTCCTCGGCGGGGAGGG - Intergenic
1003097494 6:3154363-3154385 GCTGGCTGCCCCGGCTGGTCAGG + Exonic
1003107034 6:3225251-3225273 GCTGGCTGCCCCGGCTGGTCAGG + Exonic
1004504726 6:16238650-16238672 GGCGGCGGCGACGGCGGGGCGGG - Exonic
1004864314 6:19838088-19838110 GGTGGCTGCCTCAGCAGGGCCGG - Exonic
1005394495 6:25367420-25367442 GGTGGCTGCCATTGAGGAGCAGG + Intronic
1005928555 6:30464411-30464433 GGTGGCTGTGAGCGCGGGGCTGG + Intergenic
1006170419 6:32088827-32088849 GGTGACTGTCACAGCGGAGCGGG - Intronic
1006375378 6:33668878-33668900 GGTGGCTGGCACTGTGTGGCCGG + Intronic
1006606210 6:35259595-35259617 GATGGCTGCCGCGGCGAAGCGGG + Intronic
1006840039 6:37022669-37022691 GGTGGAAGCCAAGGTGGGGCAGG - Intronic
1006992509 6:38227545-38227567 AGTGGCTGGGACGGCAGGGCTGG + Intronic
1007231319 6:40349344-40349366 GTTGGCTGCCACAGCCGGGGTGG - Intergenic
1007584231 6:42978970-42978992 GGTGGCAGCCCTGGAGGGGCCGG - Exonic
1007643596 6:43363509-43363531 GGTGGCTTCCATGGAGGGGCTGG + Intronic
1008452912 6:51673691-51673713 GGTGTCAGCCTCGGAGGGGCAGG + Intronic
1010386332 6:75284729-75284751 GGTGGCTGCGGCGGCGGCGGCGG - Exonic
1011284065 6:85705477-85705499 GCTGGCTGCTGCGGTGGGGCAGG + Intergenic
1013372534 6:109483192-109483214 TGTGGCTGCGGCGGCGGCGCAGG - Exonic
1013459052 6:110358112-110358134 GGTGGCCGCCAGGCCGGGCCCGG + Exonic
1013482387 6:110563703-110563725 GGTGGCTGCCAGGCCTGGGGTGG - Intergenic
1014018793 6:116565132-116565154 GGTAGCTGCCGCAGCGGGGCGGG + Intergenic
1014817737 6:125953640-125953662 GCTGGCTGCTGCGGAGGGGCAGG - Intergenic
1015976421 6:138795932-138795954 GGTGGCTCGCACGGCGCGGGCGG + Intronic
1016334207 6:142986932-142986954 GGCAGCTGCCAGGGCTGGGCTGG - Intergenic
1017498638 6:155003762-155003784 CGCAGCTGCCACGGTGGGGCAGG + Intronic
1017754009 6:157514422-157514444 GGTGGCTGCCAGGGTTGGGATGG + Intronic
1019356584 7:583043-583065 GGGGGCTGCCAGGGCCGGGAGGG + Intronic
1019562925 7:1666967-1666989 GGAAGCTGGCGCGGCGGGGCTGG + Intergenic
1019575447 7:1735509-1735531 GAGGGCTGACTCGGCGGGGCTGG - Intronic
1019984036 7:4642132-4642154 GGGAGCTGCCGCGCCGGGGCCGG - Intergenic
1019989557 7:4682255-4682277 GGCGGCTGCAGCGGCGGCGCGGG - Intergenic
1019995002 7:4718283-4718305 CGTGGCCGCCACGGTGGGGATGG - Intronic
1020204752 7:6105473-6105495 GGTGGCAGCCACGCGGGGGGCGG - Intronic
1020278311 7:6637521-6637543 GGCGGCGGCGGCGGCGGGGCCGG + Intronic
1022285970 7:28956544-28956566 GGCGGCAGCGACGGAGGGGCTGG + Exonic
1024472121 7:49775263-49775285 GGTGGGGGCCGCGGCGGGCCGGG + Intronic
1025033156 7:55573026-55573048 GGTGGCCTGCAAGGCGGGGCCGG - Intergenic
1026794544 7:73358248-73358270 GGTGGCTGCCACGGCTGCGCTGG - Exonic
1026973055 7:74479500-74479522 GGTGGGTGCTGCGGTGGGGCAGG + Intronic
1029104317 7:98163105-98163127 GGTGGGTGCCAGGGGTGGGCTGG + Intronic
1029264110 7:99325274-99325296 GGAGGCTGCATCTGCGGGGCAGG + Intergenic
1029711233 7:102301102-102301124 GCTGGCTGCCAAGGTGGAGCTGG + Exonic
1031859208 7:126958497-126958519 GCTGGCTGCCGCAGTGGGGCAGG - Intronic
1032197744 7:129799148-129799170 GGTGGCTGCCATGCCCTGGCTGG + Intergenic
1032525661 7:132576994-132577016 GGGGGCTGCCGCGGCGCGGCCGG - Exonic
1033654278 7:143362554-143362576 GGTGGGTACCGCGGCCGGGCGGG - Exonic
1033657074 7:143381561-143381583 GGGGGCCGCCATGGCCGGGCCGG - Exonic
1033660725 7:143399939-143399961 GGTAGAGGCCACGGCGGGTCAGG + Exonic
1034440217 7:151082387-151082409 GGTAGCTGCCATGGCTGCGCTGG + Exonic
1034885323 7:154794351-154794373 GGTGGCAGCCACGCCGGAGCCGG - Intronic
1034885326 7:154794361-154794383 CGTGGCTGCCACCTCGTGGCTGG + Intronic
1034928717 7:155143810-155143832 GGTGGCCCCCATGGCGTGGCCGG - Intergenic
1035051520 7:156001556-156001578 GGGGGCTCCCATGGAGGGGCTGG - Intergenic
1035600568 8:894721-894743 GGTGGCTGGCAGGGCAGGGTGGG + Intergenic
1035600664 8:894997-895019 GGTGGCTGGCAGGGCAGGGTGGG + Intergenic
1035600678 8:895030-895052 GGTGGCTGGCAGGGCTGGGGTGG + Intergenic
1037529245 8:19757407-19757429 GGGGGCGGCCAAGGCCGGGCTGG + Intronic
1037769201 8:21789116-21789138 GGTGGCGGCGGCGGCGGCGCCGG + Intronic
1039709448 8:40041333-40041355 GGTGACAGCCAGGGCGGGGAAGG - Intergenic
1040373264 8:46797744-46797766 GGTGGCAGCCAGGGTGGGGGAGG + Intergenic
1040447554 8:47511140-47511162 GGTGGCAGCCATGGCTGGCCGGG + Intronic
1042642989 8:70955820-70955842 GCTGGCTGCTATGGCAGGGCAGG + Intergenic
1043563475 8:81522248-81522270 GGCGGCTGCAGCGGCGGCGCTGG + Intergenic
1044692897 8:94896265-94896287 GCTGGCGGCGGCGGCGGGGCGGG - Intronic
1044973778 8:97644341-97644363 GGCCGCTGCCACCGCGGGGAGGG - Exonic
1045516291 8:102863621-102863643 GGCGGCGGCGGCGGCGGGGCTGG - Intronic
1045815106 8:106270067-106270089 GGAGGCTACCACGCCGGGGGCGG - Intergenic
1049093126 8:140531949-140531971 GCTGGCTGTCACGGAAGGGCTGG + Exonic
1049105095 8:140607759-140607781 GGTGGCTGCCAGGGGGTGGGAGG + Intronic
1049187733 8:141267065-141267087 GGGGGCTGGCAGGACGGGGCAGG + Intronic
1049318943 8:141985690-141985712 GGAGGCAGCCAGGGCTGGGCAGG - Intergenic
1049607139 8:143534945-143534967 GGGGGCTGCCGCGGGAGGGCAGG - Intronic
1049643903 8:143727677-143727699 AGCGGCTGCCACGGCGAGGATGG - Exonic
1049685455 8:143937541-143937563 TGTGGCTGCCACCGCCAGGCAGG - Intronic
1049689784 8:143953443-143953465 GGCGGCGGCGGCGGCGGGGCGGG - Intronic
1049716509 8:144095453-144095475 GCTAGCTGCCGTGGCGGGGCTGG + Intronic
1049779276 8:144420893-144420915 GGTGACTGCCAGGGCTGGGAAGG + Intergenic
1049791091 8:144473051-144473073 GGTGGGCGCCGGGGCGGGGCAGG + Exonic
1050463100 9:5893909-5893931 GGTGGGTGCCACGGGGCGGGGGG - Intronic
1051592265 9:18788380-18788402 GGTGGTTGCGGGGGCGGGGCGGG - Intronic
1052860436 9:33434867-33434889 GGTCACTGCCAGGGCTGGGCTGG - Intergenic
1053409142 9:37904265-37904287 GCAGGCCGCCGCGGCGGGGCAGG + Intronic
1054731318 9:68705205-68705227 GGCGGCTGCCGCGGCTGGGGAGG - Intergenic
1056720760 9:89069756-89069778 GGCAGCTGCCACAGCAGGGCAGG + Intronic
1057211800 9:93204577-93204599 GCTGGCTCCCACTGAGGGGCAGG + Intronic
1059375227 9:113876160-113876182 AGCGGCTGCCGCGGCGCGGCCGG + Intergenic
1060389871 9:123268473-123268495 GGTGGCGGCGGCGGCGGAGCGGG - Intronic
1060641306 9:125241381-125241403 GGCGGCCTCCACGACGGGGCTGG - Intergenic
1060735548 9:126064522-126064544 GGTGCCTGCAAGGGCTGGGCTGG - Intergenic
1061448377 9:130654981-130655003 AGGGGCTGCCAGGGCTGGGCTGG + Intergenic
1061449241 9:130659749-130659771 GCTGGCTGCCAAGGCGGGTGGGG - Intergenic
1061961916 9:133992831-133992853 GGGCGCGGCCACGGCCGGGCGGG + Intergenic
1061967700 9:134025468-134025490 CGGGGCTCCCAGGGCGGGGCCGG - Intergenic
1062188370 9:135230652-135230674 GGTGGCTGTCACGCTGGGGAGGG - Intergenic
1062354080 9:136153640-136153662 AGGGGCTGCCAGGGCGGGGCAGG + Intergenic
1062462210 9:136666685-136666707 GGGGGATGCCAGGGCGGGCCTGG - Intronic
1062539278 9:137034492-137034514 GGAGGCTGGAAAGGCGGGGCTGG - Intronic
1062696272 9:137877794-137877816 GGCGGCTGCGGCGGTGGGGCCGG + Exonic
1185871125 X:3665826-3665848 GGAGGTTGCCAGGGCAGGGCTGG + Intronic
1187648291 X:21374025-21374047 GGTGGCGGCCACGGCGGGACGGG - Intergenic
1188830567 X:34891620-34891642 GGTGCATGCCACTGAGGGGCAGG - Intergenic
1193082695 X:77421594-77421616 AGTGGCTGCCACACTGGGGCAGG - Intergenic
1195503946 X:105635433-105635455 GGTGGGTGCCACGGAAGGTCAGG + Intronic
1196639350 X:118039830-118039852 GGTGGTTGCCACAGAGGTGCTGG + Intronic
1197183545 X:123562457-123562479 GCTGGCTGCCCCGGCTGGTCAGG - Intergenic
1197750659 X:129961478-129961500 AGTGGCAGCCAGTGCGGGGCGGG - Intergenic
1200090277 X:153632765-153632787 TGTGGCTGCCAGGGCCAGGCTGG - Intergenic
1200126908 X:153819494-153819516 CGTGGCTGCCACGGAGGTGGGGG + Intronic
1200213943 X:154359216-154359238 GGTGGCGGCCAGGGCAGGGCTGG - Intronic
1200256738 X:154586324-154586346 GGTGGCGGTCACAGCGTGGCAGG + Intronic
1200261031 X:154618079-154618101 GGTGGCGGTCACAGCGTGGCAGG - Intronic
1202601930 Y:26602200-26602222 GGTGGCTGCAAGGCCGGGGGAGG + Intergenic