ID: 900216051

View in Genome Browser
Species Human (GRCh38)
Location 1:1482244-1482266
Sequence CCTTCAGGCGGATCTGCTCG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 2, 1: 0, 2: 0, 3: 4, 4: 63}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900216051_900216058 15 Left 900216051 1:1482244-1482266 CCGCGAGCAGATCCGCCTGAAGG 0: 2
1: 0
2: 0
3: 4
4: 63
Right 900216058 1:1482282-1482304 AGACCGTCTTGGAGTCCATCAGG 0: 2
1: 1
2: 0
3: 2
4: 38
900216051_900216056 4 Left 900216051 1:1482244-1482266 CCGCGAGCAGATCCGCCTGAAGG 0: 2
1: 0
2: 0
3: 4
4: 63
Right 900216056 1:1482271-1482293 CGAGCACCGTCAGACCGTCTTGG 0: 2
1: 0
2: 0
3: 0
4: 16
900216051_900216061 30 Left 900216051 1:1482244-1482266 CCGCGAGCAGATCCGCCTGAAGG 0: 2
1: 0
2: 0
3: 4
4: 63
Right 900216061 1:1482297-1482319 CCATCAGGTGAGCACTGCCCAGG 0: 1
1: 1
2: 4
3: 12
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900216051 Original CRISPR CCTTCAGGCGGATCTGCTCG CGG (reversed) Exonic