ID: 900216051

View in Genome Browser
Species Human (GRCh38)
Location 1:1482244-1482266
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 2, 1: 0, 2: 0, 3: 4, 4: 63}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900216051_900216061 30 Left 900216051 1:1482244-1482266 CCGCGAGCAGATCCGCCTGAAGG 0: 2
1: 0
2: 0
3: 4
4: 63
Right 900216061 1:1482297-1482319 CCATCAGGTGAGCACTGCCCAGG 0: 1
1: 1
2: 4
3: 12
4: 204
900216051_900216056 4 Left 900216051 1:1482244-1482266 CCGCGAGCAGATCCGCCTGAAGG 0: 2
1: 0
2: 0
3: 4
4: 63
Right 900216056 1:1482271-1482293 CGAGCACCGTCAGACCGTCTTGG 0: 2
1: 0
2: 0
3: 0
4: 16
900216051_900216058 15 Left 900216051 1:1482244-1482266 CCGCGAGCAGATCCGCCTGAAGG 0: 2
1: 0
2: 0
3: 4
4: 63
Right 900216058 1:1482282-1482304 AGACCGTCTTGGAGTCCATCAGG 0: 2
1: 1
2: 0
3: 2
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900216051 Original CRISPR CCTTCAGGCGGATCTGCTCG CGG (reversed) Exonic
900216051 1:1482244-1482266 CCTTCAGGCGGATCTGCTCGCGG - Exonic
900223171 1:1520247-1520269 CCTTCAGGCGGATCTGCTCGCGG - Exonic
1063497716 10:6525767-6525789 CTTTGAGGGGGATCTGCTGGAGG + Intronic
1071728115 10:88219914-88219936 CCTTCAGGGGAATCTCCTCTGGG + Intergenic
1075389005 10:122078738-122078760 CCCTTAGGCAGATCTGCTCCTGG + Intronic
1077021862 11:420520-420542 CGTCCAGGCGGATCTCCACGAGG + Exonic
1077033165 11:479384-479406 CCTCCAGGAGCATCTGCTGGTGG + Intronic
1084757924 11:71251282-71251304 CCTCCAGGCGGGTCTGCGTGCGG - Intronic
1088219002 11:107547440-107547462 CCTTCAGGTGTATCTGTTCTAGG - Intronic
1092117400 12:6019133-6019155 CGATGAGGCGGATCTGCTTGAGG + Exonic
1095032642 12:37313101-37313123 CCTTTAGAGGGATCTGCTTGTGG + Intergenic
1101994670 12:109516475-109516497 CCTTGAGGAGGATTTTCTCGTGG + Intronic
1105307255 13:19177592-19177614 CCCTCAGGCGGATCTGTGCACGG - Exonic
1113821956 13:113221056-113221078 CCTTCAGGAGGGTCTCCTCTGGG - Intronic
1122728319 14:103775775-103775797 CTTCCAGGCGGATCTGCTTCAGG - Intronic
1131942589 15:97583923-97583945 TCTTCAGGTTGATCTTCTCGTGG + Intergenic
1135510600 16:23079884-23079906 CCTTCAGACGGGTTTGCTTGTGG - Intronic
1142122968 16:88396403-88396425 CCTTCAGGAGGGTCTCCTCCTGG - Intergenic
1142123013 16:88396538-88396560 CCTTCAGGAGGGTCTCCTCCCGG - Intergenic
1142123040 16:88396619-88396641 CCTTCAGGAGGGTCTCCTCCCGG - Intergenic
1142123060 16:88396673-88396695 CCTTCAGACGGGTCTCCTCCCGG - Intergenic
1142123107 16:88396835-88396857 CCTTCAGGAGGGTCTCCTCCAGG - Intergenic
1142123136 16:88396916-88396938 CCTTCAGACGGGTCTCCTCCCGG - Intergenic
1142123152 16:88396970-88396992 CCTTCAGGAGGGTCTCCTCCTGG - Intergenic
1142123162 16:88396997-88397019 CCTTCAGGAGGGTCTCCTCCCGG - Intergenic
1151975629 17:77482274-77482296 CCTTCCGGCGCATCTGCTCCAGG - Exonic
1155682916 18:28511954-28511976 GCTTCAGGCGTATCTTCTCCTGG + Intergenic
1160568619 18:79801673-79801695 CCTTCAGGCTGATCTGAATGTGG + Intergenic
1161203668 19:3029287-3029309 CCTTAAGGCGGCTCAGCCCGCGG - Intronic
1162001099 19:7745596-7745618 CCTTCAGCCGGGTCAGCTCCTGG + Exonic
1162001109 19:7745665-7745687 CCTTCAGCCGGGTCAGCTCCTGG + Exonic
1162001136 19:7745872-7745894 CCTTCAGCCGGGTCAGCTCCTGG + Exonic
1162004044 19:7765831-7765853 CCTTCAGCCGGGTCAGCTCCTGG - Exonic
1162004055 19:7765900-7765922 CCTTCAGCCGGGTCAGCTCCTGG - Exonic
1162004066 19:7765969-7765991 CCTTCAGCCGGGTCAGCTCCTGG - Exonic
926202964 2:10814380-10814402 CATTCAGGAGGAGCTGCCCGGGG - Intronic
934470772 2:94531612-94531634 CCTTCAGGAGAATCTGCAAGTGG - Intergenic
940096090 2:149977866-149977888 CCTTCAGAAGGACCTGCTTGAGG - Intergenic
942043502 2:172085962-172085984 CCTCCAGGCGGCTCTGGGCGAGG - Exonic
1175487580 20:59356484-59356506 CCTTCTGAAGGATCTGCTGGAGG - Intergenic
1175823321 20:61923606-61923628 CCTCCAGGCGGATCAGCTTGTGG - Exonic
1176762610 21:12971059-12971081 CCTTCAGGAGAATCTGCAAGTGG - Intergenic
1178802684 21:35810840-35810862 CCTTCAGGCTGATTTGATCTAGG + Intronic
1180072597 21:45443772-45443794 CCTTTACGCGGCTCTGCTGGTGG + Intronic
1180201656 21:46228457-46228479 CTTCCAGGCCGGTCTGCTCGCGG + Exonic
1180568839 22:16697546-16697568 CAATGAGGCGGATCTGCTTGAGG + Intergenic
1181527928 22:23500798-23500820 CCTTCAGGGGGAGATGCTCAGGG - Intergenic
1185385416 22:50529580-50529602 GCTTCATGCGGATCAGCTCCGGG + Exonic
949622563 3:5830908-5830930 CCTTGAGGTGGATCTACTCCAGG - Intergenic
949966767 3:9363233-9363255 ACTTCAGGCGGATCTCGTGGCGG + Exonic
966996199 3:185283032-185283054 CCTGCGGGCGGATCTGAACGGGG + Intronic
970600267 4:17636557-17636579 CCTTCAGGCGGGTCTGCAGGCGG + Exonic
979582768 4:122379544-122379566 GCTTCAGGCCGCTCTGCGCGAGG - Intronic
982753787 4:159194338-159194360 CCTTCAGGCAGATCAGGTCCTGG + Intronic
987292865 5:16524845-16524867 CCTGCAGGTGGATGTGCGCGGGG + Intronic
987292877 5:16524897-16524919 CCTGCAGGTGGATGTGCGCGGGG + Intronic
987292910 5:16525053-16525075 CCTGCAGGTGGATGTGCGCGGGG + Intronic
1003936150 6:10977024-10977046 CTTTCAGGGGGATTTGCTAGAGG + Intronic
1019595513 7:1856624-1856646 AGTTCAGGAGGAGCTGCTCGCGG + Intronic
1021921871 7:25493931-25493953 CCTTCATGCTGACCTGCTGGAGG + Intergenic
1023365395 7:39458545-39458567 GCTCCAGGCTGATGTGCTCGTGG + Intronic
1036453633 8:8890967-8890989 CCTGCAGGCGGGTCTGACCGAGG - Exonic
1038005044 8:23422861-23422883 CCGTCAGACGGAGCTGCTCTCGG - Intronic
1043529385 8:81133080-81133102 CCTTCAGGGGAAACTGCTTGGGG - Intergenic
1048434908 8:134407176-134407198 CCTTCAGTGGGATCTGCCCAAGG + Intergenic
1060970043 9:127732609-127732631 CCTGCAGGAGGATCTCCTCGCGG + Exonic
1061248297 9:129412919-129412941 CCTTCAGGCCCATCTGATCCCGG + Intergenic
1061256320 9:129455692-129455714 CCTTCAGGGGGAGATGCTCAGGG + Intergenic
1200043742 X:153388585-153388607 CCCTCTGGAGGAGCTGCTCGAGG + Intergenic