ID: 900216563

View in Genome Browser
Species Human (GRCh38)
Location 1:1485126-1485148
Sequence GACGTCCCGCATCACGGTGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 107}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900216553_900216563 22 Left 900216553 1:1485081-1485103 CCGCTTCATCGAGGCTCGGCTGG 0: 2
1: 1
2: 0
3: 3
4: 61
Right 900216563 1:1485126-1485148 GACGTCCCGCATCACGGTGCTGG 0: 1
1: 0
2: 0
3: 4
4: 107
900216559_900216563 -6 Left 900216559 1:1485109-1485131 CCGTCCCTAGTGAGGGAGACGTC 0: 3
1: 0
2: 0
3: 4
4: 68
Right 900216563 1:1485126-1485148 GACGTCCCGCATCACGGTGCTGG 0: 1
1: 0
2: 0
3: 4
4: 107
900216560_900216563 -10 Left 900216560 1:1485113-1485135 CCCTAGTGAGGGAGACGTCCCGC 0: 3
1: 0
2: 0
3: 3
4: 24
Right 900216563 1:1485126-1485148 GACGTCCCGCATCACGGTGCTGG 0: 1
1: 0
2: 0
3: 4
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900216563 Original CRISPR GACGTCCCGCATCACGGTGC TGG Exonic
900216563 1:1485126-1485148 GACGTCCCGCATCACGGTGCTGG + Exonic
904468443 1:30721567-30721589 GAACTCCTGCTTCACGGTGCTGG + Exonic
904800058 1:33086290-33086312 GAGGTTCCGCATCAGGGTGGTGG + Intronic
910897877 1:92086829-92086851 GAAGTCCAACATCAAGGTGCTGG - Intronic
911228522 1:95334356-95334378 GAAGTCCCAGATCAAGGTGCTGG + Intergenic
916247577 1:162704545-162704567 GACGTCCAAGATCAAGGTGCTGG + Intronic
916689416 1:167176328-167176350 GAAGTCCAGGATCAAGGTGCTGG + Intergenic
918506678 1:185262643-185262665 GAAGTCCAGGATCAAGGTGCTGG + Intronic
918743334 1:188165430-188165452 GAAGTCCCAAATCAAGGTGCTGG + Intergenic
919565473 1:199179972-199179994 GATGTCCCAAATCAAGGTGCTGG - Intergenic
1063348661 10:5335238-5335260 GATCTCCCGCATCACCTTGCAGG - Intergenic
1067127834 10:43535253-43535275 GAAGTCCATCATCAAGGTGCTGG + Intergenic
1068149808 10:53117424-53117446 GAAGTCCAAAATCACGGTGCTGG - Intergenic
1072690481 10:97569654-97569676 GAAATCCGGCATCATGGTGCTGG + Intronic
1072758055 10:98033666-98033688 GAAGTCCCAGATCAAGGTGCTGG - Intergenic
1077999475 11:7482060-7482082 GAAGTCCCAGATCACGGTGTGGG + Intergenic
1080450113 11:32372011-32372033 GAAGTCCAACATCAAGGTGCAGG - Intergenic
1088724545 11:112622554-112622576 GACGTCCAAGATCAAGGTGCTGG - Intergenic
1096651181 12:53062676-53062698 GACCTCCTGCGTCAGGGTGCTGG + Exonic
1097690964 12:62734219-62734241 GAAGTCCAACATCAAGGTGCTGG - Intronic
1097838407 12:64296947-64296969 GAAGTCCAGTATCAAGGTGCTGG - Intronic
1103326469 12:120124658-120124680 GTCCTCCCGCATCACAGTGTTGG + Intergenic
1104922061 12:132295695-132295717 GCGGTCCAGAATCACGGTGCTGG - Intronic
1106681308 13:32011427-32011449 GAAGTCCCAGATCAAGGTGCTGG + Intergenic
1110042810 13:70786633-70786655 GACGTTCCAGATCAAGGTGCTGG - Intergenic
1111769105 13:92573869-92573891 GAAGTCCCTCTTCAGGGTGCAGG - Intronic
1113482831 13:110634307-110634329 GATGTCCAACATCAAGGTGCCGG + Intronic
1113632390 13:111897205-111897227 GAAGTCCAAGATCACGGTGCTGG - Intergenic
1113697199 13:112354872-112354894 GAGCTCCTGCACCACGGTGCTGG - Intergenic
1118843742 14:69530693-69530715 GACGTCCAATATCAAGGTGCTGG + Exonic
1121607989 14:95255184-95255206 GAAGTCCAGGATCAAGGTGCCGG - Intronic
1124660503 15:31546600-31546622 GAAGTCCCAGATCAAGGTGCTGG - Intronic
1124888951 15:33713730-33713752 GAAGTCCAGGATCAAGGTGCTGG + Intronic
1125033611 15:35097756-35097778 GACGTCCAAGATCAAGGTGCTGG - Intergenic
1125772612 15:42180054-42180076 GAAGTCCCAGATCAGGGTGCCGG - Intronic
1126036246 15:44548634-44548656 GAAGTCCAGTATCAAGGTGCTGG + Intronic
1132367536 15:101268341-101268363 GAAGTCCAGGATCAGGGTGCAGG - Intergenic
1133219795 16:4315313-4315335 GAGGTCCCGGATCCCGATGCCGG - Exonic
1135402850 16:22178197-22178219 GACGTACCGCCACACGGGGCAGG - Exonic
1135644098 16:24146202-24146224 GAAGTCCCAAATCAAGGTGCTGG - Intronic
1143878690 17:10013227-10013249 GAAGTCCAGGATCAAGGTGCTGG - Intronic
1151511587 17:74564232-74564254 CACGGCGCCCATCACGGTGCTGG + Intergenic
1151596173 17:75079168-75079190 GTCTTCCCACATCACGGGGCTGG + Intergenic
1154305844 18:13230212-13230234 GACGTCCAAGATCAAGGTGCCGG - Intronic
1158950301 18:62488283-62488305 GAAGTCCACAATCACGGTGCTGG + Intergenic
1160595470 18:79970654-79970676 GAAGTCCCAGATCAAGGTGCTGG - Exonic
1163478886 19:17542864-17542886 GACATCCCCCATCCTGGTGCAGG - Intronic
1163553884 19:17982055-17982077 GAAGACCAGCAGCACGGTGCCGG - Exonic
939944163 2:148388630-148388652 GAAGTCCAGAATCAAGGTGCTGG + Intronic
940049879 2:149451120-149451142 GAAGTCCCAGATCAAGGTGCCGG + Intronic
947336548 2:229091637-229091659 GAAGTCCAACATCAAGGTGCTGG - Intronic
1172305925 20:33880687-33880709 GAAGTCCCAGATCAGGGTGCTGG - Intergenic
1173424542 20:42931387-42931409 GAAGTCCCACATCAAGGTTCTGG - Intronic
1177582241 21:23039747-23039769 GAAGTCCCAGATCAGGGTGCTGG - Intergenic
1180193933 21:46182521-46182543 GACCTCCCGCATCAGGGAGCTGG + Intronic
1182997546 22:34828064-34828086 GACCTCCAACATCAAGGTGCTGG + Intergenic
1184815998 22:46870675-46870697 GAGGTCTCGCATCAAGGTGCCGG + Intronic
950534528 3:13571393-13571415 CACGTCCCGCAGCACTGGGCCGG + Exonic
964161225 3:153648042-153648064 GAAGTCCCAGATCAAGGTGCTGG - Intergenic
964492383 3:157250624-157250646 GAAGTCCAACATCAGGGTGCTGG + Intergenic
969273537 4:6119126-6119148 GAAGTCCCAAATCACAGTGCTGG - Intronic
969590751 4:8120575-8120597 GAAGTCCCAGATCAAGGTGCGGG - Intronic
971463492 4:26927999-26928021 GAAGTCCAACATCAAGGTGCTGG + Intronic
971569594 4:28193999-28194021 AAAGTCCCACATCAAGGTGCTGG - Intergenic
971757739 4:30722798-30722820 CACGTCGCCCACCACGGTGCAGG - Exonic
980979942 4:139646111-139646133 GAAGTCCCAGATCAAGGTGCTGG - Intergenic
984606787 4:181795249-181795271 GAAGCCCAGCATCAAGGTGCTGG + Intergenic
985768467 5:1794585-1794607 GAAGTCCAGCATCAAGGCGCCGG + Intergenic
985835610 5:2269898-2269920 GACGTCCAGGATCAGGGTGTGGG + Intergenic
990283778 5:54279356-54279378 GAAGTCCCAGATCAGGGTGCCGG + Intronic
990447169 5:55903887-55903909 GAAGTCCCACATCAAGGTGCTGG + Intronic
1002787997 6:419000-419022 GAGGTCCCGCATGGGGGTGCTGG - Intergenic
1002788033 6:419095-419117 GAGGTCCCGCATGGGGGTGCTGG - Intergenic
1002788047 6:419127-419149 GAGGTCCCGCATGGGGGTGCTGG - Intergenic
1002788060 6:419159-419181 GAGGTCCCGCATGGGGGTGCTGG - Intergenic
1002788074 6:419191-419213 GAGGTCCCGCATGGGGGTGCTGG - Intergenic
1002788088 6:419223-419245 GAGGTCCCGCATGGGGGTGCTGG - Intergenic
1002788101 6:419255-419277 GAGGTCCCGCATGGGGGTGCTGG - Intergenic
1002788115 6:419287-419309 GAGGTCCCGCATGGGGGTGCTGG - Intergenic
1004606448 6:17199713-17199735 GAAGTCCCAGATCAAGGTGCTGG + Intergenic
1007298594 6:40848414-40848436 GACGTCCAAGATCAAGGTGCTGG + Intergenic
1007665210 6:43509723-43509745 GATGTCCCGCACCTCGGCGCCGG + Exonic
1010977217 6:82329440-82329462 GAAGTCCCAAATCACGGTGTTGG - Intergenic
1011079167 6:83470775-83470797 GAGGTCCAGGATCAAGGTGCCGG - Intergenic
1011613700 6:89179013-89179035 GCCGTCCAGCATCGCAGTGCGGG + Exonic
1012969165 6:105708076-105708098 GAAGTCCAACATCAAGGTGCTGG - Intergenic
1013787598 6:113799021-113799043 GAAGTCCCACATCAAGGTGAGGG - Intergenic
1014273890 6:119365272-119365294 GAAGTCCAGGATCAAGGTGCTGG + Intergenic
1015204303 6:130617701-130617723 GAAGTCCCAGATCAAGGTGCTGG + Intergenic
1018276471 6:162137600-162137622 GAGGTCCAGTATCAAGGTGCTGG + Intronic
1018992339 6:168683774-168683796 GCCGCCCCACATCACTGTGCTGG - Intergenic
1019793577 7:3033368-3033390 GAAGTCCTGGATCAAGGTGCCGG - Intronic
1020110295 7:5443986-5444008 GAAGTCCCAGATCAAGGTGCAGG - Intronic
1026563695 7:71472048-71472070 GAAGTCCAACATCAAGGTGCTGG + Intronic
1028586248 7:92454842-92454864 GAAGTCCAACATCAAGGTGCTGG + Intronic
1030376227 7:108756062-108756084 GACTCCCCGCATCACTTTGCTGG + Intergenic
1030859255 7:114604120-114604142 GAGGTCCAGGATCAAGGTGCTGG + Intronic
1031660352 7:124416552-124416574 GACGTCCAAGATCAGGGTGCCGG - Intergenic
1033048442 7:137982992-137983014 GAAGTCCAGGATCAAGGTGCTGG - Intronic
1033403967 7:141054221-141054243 GAAGTCCCAGATCAAGGTGCTGG + Intergenic
1034499912 7:151443090-151443112 GAAGTCTAACATCACGGTGCTGG - Intergenic
1034908151 7:154969475-154969497 GTGGTGCCGCAGCACGGTGCAGG - Intronic
1044155015 8:88835039-88835061 GAAGTCCAGTATCAAGGTGCTGG - Intergenic
1053375301 9:37600987-37601009 GAAGTCCAGGATCAAGGTGCTGG + Intronic
1056775844 9:89512092-89512114 GAAGTCCCAGATCAAGGTGCTGG - Intergenic
1057934057 9:99221917-99221939 GAAGACCCCCATCAGGGTGCGGG - Exonic
1062220103 9:135410460-135410482 GAAGTCCCGAATCAAGGTGCTGG - Intergenic
1062268484 9:135698280-135698302 GTCCTCCGGCATCACGGTGATGG - Intronic
1187146981 X:16645945-16645967 GAAGTCCCAGATCAAGGTGCTGG - Intronic
1189775956 X:44470312-44470334 GAAGTCCAGGATCAGGGTGCTGG - Intergenic
1194780246 X:98015796-98015818 GAAGTCCAGGATCAAGGTGCTGG + Intergenic
1197404507 X:126033621-126033643 GACGTCCATGATCAAGGTGCTGG + Intergenic