ID: 900216872

View in Genome Browser
Species Human (GRCh38)
Location 1:1486349-1486371
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 3, 1: 0, 2: 0, 3: 5, 4: 70}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900216872_900216881 15 Left 900216872 1:1486349-1486371 CCCTCGTGTAGGCTCAGGGTGCT 0: 3
1: 0
2: 0
3: 5
4: 70
Right 900216881 1:1486387-1486409 GCCTCCCATCTTCCAGGCGGGGG 0: 3
1: 0
2: 0
3: 16
4: 170
900216872_900216877 9 Left 900216872 1:1486349-1486371 CCCTCGTGTAGGCTCAGGGTGCT 0: 3
1: 0
2: 0
3: 5
4: 70
Right 900216877 1:1486381-1486403 AGCAGCGCCTCCCATCTTCCAGG 0: 3
1: 0
2: 0
3: 16
4: 182
900216872_900216878 12 Left 900216872 1:1486349-1486371 CCCTCGTGTAGGCTCAGGGTGCT 0: 3
1: 0
2: 0
3: 5
4: 70
Right 900216878 1:1486384-1486406 AGCGCCTCCCATCTTCCAGGCGG 0: 3
1: 0
2: 1
3: 13
4: 178
900216872_900216880 14 Left 900216872 1:1486349-1486371 CCCTCGTGTAGGCTCAGGGTGCT 0: 3
1: 0
2: 0
3: 5
4: 70
Right 900216880 1:1486386-1486408 CGCCTCCCATCTTCCAGGCGGGG 0: 3
1: 0
2: 3
3: 10
4: 271
900216872_900216879 13 Left 900216872 1:1486349-1486371 CCCTCGTGTAGGCTCAGGGTGCT 0: 3
1: 0
2: 0
3: 5
4: 70
Right 900216879 1:1486385-1486407 GCGCCTCCCATCTTCCAGGCGGG 0: 3
1: 0
2: 1
3: 17
4: 342
900216872_900216886 30 Left 900216872 1:1486349-1486371 CCCTCGTGTAGGCTCAGGGTGCT 0: 3
1: 0
2: 0
3: 5
4: 70
Right 900216886 1:1486402-1486424 GGCGGGGGACGTCTCCTGTCTGG 0: 3
1: 0
2: 0
3: 2
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900216872 Original CRISPR AGCACCCTGAGCCTACACGA GGG (reversed) Intronic
900211046 1:1456030-1456052 AGCACCCTGAGCCTACACGAGGG - Intronic
900216872 1:1486349-1486371 AGCACCCTGAGCCTACACGAGGG - Intronic
900223953 1:1524078-1524100 AGCACCCTGAGCCTACACGAGGG - Intronic
900345523 1:2208592-2208614 AGCACCCTGAGCCCATACCTGGG + Intronic
901379136 1:8861287-8861309 AGCTGCCTGAGCTGACACGAGGG + Exonic
903184346 1:21620742-21620764 AGCCCCCAGAGCCTCCAGGATGG + Intronic
904211566 1:28889439-28889461 GGCACCTGGAGCCTACAGGAGGG - Intronic
904285627 1:29451682-29451704 AGCACCCTGAGCCCCCACTGGGG - Intergenic
913175078 1:116266147-116266169 TGCACCCTGGGCCTGCAGGATGG + Intergenic
920117215 1:203629374-203629396 TGCACTCTGAGCCTCCACGATGG - Intronic
924382320 1:243475747-243475769 AGCACCTTGAGCCTTGAGGAAGG - Intronic
1065131779 10:22628981-22629003 AACACCCTTGGCCTACAGGAGGG + Intronic
1066307036 10:34155471-34155493 AGAACCCTAAGCTTACATGAAGG + Intronic
1074782089 10:116809330-116809352 AGCACCCTGAACCCTCATGAAGG + Intergenic
1076491803 10:130866814-130866836 ACCATCCTGAGCCTTCAGGAAGG + Intergenic
1081857952 11:46315910-46315932 AGCACCCTGAGCTGATAAGAAGG - Intronic
1089321045 11:117626903-117626925 AGCACCCTGATCCTCCAGGAAGG + Intronic
1091372501 11:135072713-135072735 AGCACACTGAGTCTAGACCAGGG + Intergenic
1094000252 12:25686897-25686919 AGCACCCTGTGTCTACCTGAAGG + Intergenic
1100734531 12:97512579-97512601 AGCACCCTGTGCCTAGCCCAGGG - Intergenic
1103717024 12:122950706-122950728 AGCACCCTGGGGCCCCACGATGG - Intronic
1103848229 12:123914557-123914579 GGCACCCTGAGCCAGCAGGAGGG + Intronic
1104575715 12:129964212-129964234 AGCACCCTGAGAATGCATGAAGG + Intergenic
1106846672 13:33744421-33744443 AGCACCCTGAGTGCACACGCAGG - Intergenic
1112430754 13:99348343-99348365 AGAACCCTGAGCCTAAACAGTGG + Intronic
1116341869 14:43733493-43733515 AGCACCCTGAGCCTGAAGGAGGG - Intergenic
1202860295 14_GL000225v1_random:77864-77886 AGCAGCCTGAACCTAGACAAGGG - Intergenic
1124848725 15:33315388-33315410 AGCACCCAGAGCCTGGAGGAAGG - Intronic
1126318858 15:47400198-47400220 ACCACGCTCAGCCTACAGGAAGG - Intronic
1127981205 15:64036730-64036752 AGGGCCCTGAGTCTACACTAGGG + Intronic
1128866647 15:71119588-71119610 AGCCCCCTCAGCTTACTCGAAGG + Intronic
1129235544 15:74221797-74221819 AGCACCCTGAGCCTCTGGGAAGG - Intergenic
1129266337 15:74395497-74395519 AACACTCTGAGCCTTCATGAAGG + Intergenic
1130894154 15:88157671-88157693 ACCTCCCTTGGCCTACACGAGGG + Intronic
1132840531 16:1976582-1976604 AGGACCCTGTGCCTACATGCAGG - Intronic
1135223753 16:20637602-20637624 AACACCTTGAGCCTAGACTAAGG - Intronic
1144848823 17:18233881-18233903 ACCACCCTGACCCTGCTCGAGGG + Exonic
1152230894 17:79113534-79113556 AGCACCCAGAGCCCAGAGGATGG - Intronic
1153868755 18:9297241-9297263 CGCAGCCTGAGCCTCCCCGACGG + Intergenic
1161518347 19:4709802-4709824 AGCACCCTGGGCCAACAGGAGGG + Intronic
1163547084 19:17947135-17947157 AGCACCCAGAGCCGCCAGGAAGG + Intergenic
1167513103 19:49907217-49907239 AGCACCCTGAGCCTGTACCTTGG - Intronic
1167521424 19:49958366-49958388 AGCTCCCTGAGCCTCCATGGAGG - Exonic
1167756113 19:51414904-51414926 AGCTCCCTGAGCCTCCATGGAGG - Exonic
1167784697 19:51627542-51627564 AGCTCCCTGATCCTCCACGGGGG - Exonic
927707009 2:25302597-25302619 GGCACCCTGAGCCCTCATGAAGG - Intronic
927846019 2:26473311-26473333 AGGAGCCTGAGCCTCCAAGAAGG + Intronic
935878274 2:107535884-107535906 AGCACCCTGAGTCTAGCTGAAGG - Intergenic
942525386 2:176847739-176847761 AGCACCCTAAGGCTTCACTAGGG + Intergenic
946599308 2:221342067-221342089 AACACACTGGGCCTACATGAGGG + Intergenic
1179724076 21:43332024-43332046 AGCACCCTGACCCTCCAAGTTGG - Intergenic
949271596 3:2223913-2223935 AGCGTCCTGAGCTTACACAAAGG + Intronic
964645581 3:158955711-158955733 AGCACCCAGAGCCAACACTTTGG + Intergenic
969301550 4:6300201-6300223 ACCTCCCTGAGCCTCCATGAAGG - Intronic
981692619 4:147526457-147526479 AGGACCCTGAGACTACATGGAGG - Intronic
987078476 5:14405362-14405384 AGCCCCCTGTGCCTAGCCGAGGG - Intronic
992484245 5:77180316-77180338 AGCAACCAGAGCCTTCACGTGGG + Intergenic
992792958 5:80230098-80230120 AGCAGGCTGAGCCTCCAAGAGGG - Intronic
999369879 5:151048221-151048243 TGCACCCTGAACCTCCGCGAGGG + Intronic
999705926 5:154272396-154272418 AGGACCCTGAGCCTAAAAGAAGG - Intronic
1000154419 5:158536571-158536593 TGCACCCTGGGCATACACCAGGG - Intergenic
1002758066 6:179897-179919 AGCAGCCTGAGCCTGCCCAAGGG + Intergenic
1002774030 6:313639-313661 AGCACCCGGAGACTACAATAGGG - Intronic
1008211024 6:48726286-48726308 ACCACTCTGAGCCAACAAGATGG - Intergenic
1008484977 6:52025851-52025873 AGCAGCCTGAGCCTGCATGTGGG - Exonic
1024776199 7:52789302-52789324 AGCACCCTGAACCTGCACCTGGG + Intergenic
1034763100 7:153692345-153692367 AGCCCCCTTTGCCTACACAATGG + Intergenic
1035660387 8:1343415-1343437 GGCACCCCAAGCCTACATGATGG - Intergenic
1036571037 8:9980042-9980064 AGAACCCAGAGCCTCCATGATGG + Intergenic
1036962958 8:13265849-13265871 ACCACCCTGTGCATACCCGAAGG - Intronic
1052412687 9:28142737-28142759 AGCATCCTTAACCTACCCGATGG - Intronic
1057272712 9:93659757-93659779 AGGACCCTGAGCCCTCACAAAGG - Intronic
1062118763 9:134822792-134822814 ACCACCCTGTGTCTCCACGAGGG + Intronic
1187305925 X:18095164-18095186 AGAACCCTGAGCCTTCAAAAGGG + Intergenic
1187448206 X:19375720-19375742 AGCACCCTGAGCTCACTCGGCGG - Intronic
1191784034 X:64897962-64897984 CGCATCCTGAGACTACATGAAGG + Intergenic
1197755870 X:129994245-129994267 AGCACCCATAGCCTACACTGCGG - Intronic
1202100550 Y:21303632-21303654 ACCAGCCTGAGCCTCCTCGACGG - Intergenic