ID: 900217148

View in Genome Browser
Species Human (GRCh38)
Location 1:1487628-1487650
Sequence TCTGTTGCCCCCTGTGTAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 186}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900217142_900217148 22 Left 900217142 1:1487583-1487605 CCATGTGTGGTTGGCTGGTGTGT 0: 1
1: 0
2: 2
3: 16
4: 195
Right 900217148 1:1487628-1487650 TCTGTTGCCCCCTGTGTAGTTGG 0: 1
1: 0
2: 0
3: 19
4: 186
900217141_900217148 23 Left 900217141 1:1487582-1487604 CCCATGTGTGGTTGGCTGGTGTG 0: 1
1: 0
2: 1
3: 9
4: 145
Right 900217148 1:1487628-1487650 TCTGTTGCCCCCTGTGTAGTTGG 0: 1
1: 0
2: 0
3: 19
4: 186
900217147_900217148 -9 Left 900217147 1:1487614-1487636 CCTGCAGGGCAGAGTCTGTTGCC 0: 1
1: 1
2: 3
3: 18
4: 223
Right 900217148 1:1487628-1487650 TCTGTTGCCCCCTGTGTAGTTGG 0: 1
1: 0
2: 0
3: 19
4: 186
900217140_900217148 24 Left 900217140 1:1487581-1487603 CCCCATGTGTGGTTGGCTGGTGT 0: 1
1: 0
2: 0
3: 16
4: 145
Right 900217148 1:1487628-1487650 TCTGTTGCCCCCTGTGTAGTTGG 0: 1
1: 0
2: 0
3: 19
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900217148 Original CRISPR TCTGTTGCCCCCTGTGTAGT TGG Intronic
900217138 1:1487574-1487596 GCTGTTGCCCCATGTGTGGTTGG + Intronic
900217148 1:1487628-1487650 TCTGTTGCCCCCTGTGTAGTTGG + Intronic
901764681 1:11492255-11492277 TCTGGTGTCCCCTCTCTAGTGGG - Intronic
905528603 1:38658680-38658702 TCTGTGGCCCCATCTGAAGTGGG + Intergenic
906185864 1:43861533-43861555 TCGGTTGCATCCTGTGTAGCTGG - Intronic
906315323 1:44783344-44783366 ACTTTTTCCCCCTGTGTGGTTGG + Intergenic
906933430 1:50191143-50191165 TCTGTTGCCCTCTTTGGACTTGG + Intronic
911265309 1:95736250-95736272 ACTGTTGTTCCTTGTGTAGTTGG - Intergenic
913132373 1:115852757-115852779 TCTGTTGCCCGCTTTTTAATGGG + Intergenic
915593037 1:156881404-156881426 TCTCTTGCCCCCAGCCTAGTGGG + Intronic
917738173 1:177939044-177939066 TCTGTTTCTCACTGTGTAGCAGG - Intronic
920139753 1:203800239-203800261 TAAGTTGCCCCATGTGTAGTTGG + Exonic
923313509 1:232757921-232757943 TATGTTACCCCCTCTGTATTTGG + Intergenic
1065330995 10:24599358-24599380 TCTGATGCCCTCTGTATAGCGGG + Intronic
1065503015 10:26400343-26400365 CCAGTTGCTCCCTGTGGAGTTGG - Intergenic
1065543474 10:26794303-26794325 TCTCCTGCCTCCTGTGTAGCTGG - Intronic
1070669826 10:78369970-78369992 TCTGCTTTCCCCTGTGTAGCCGG + Intergenic
1071510729 10:86261048-86261070 TGTTTTGCTCCCTGTGGAGTGGG - Intronic
1072211871 10:93253754-93253776 GCTTTAGCCCCCTGAGTAGTTGG + Intergenic
1074644736 10:115435128-115435150 TCTCCTGCCTCCTGAGTAGTTGG + Intronic
1076121013 10:127936541-127936563 TCTGAAGACCCCTGTGGAGTGGG - Intronic
1076518764 10:131066090-131066112 TCTTTTGCTCCCTGTGAAGCAGG + Intergenic
1076601629 10:131660561-131660583 TCTGAGGCCCCCTGTGAGGTAGG - Intergenic
1077646845 11:3932712-3932734 TCTCTTGCCCCTTCTGCAGTGGG + Intronic
1080996403 11:37607468-37607490 TCTTTTGCCCACTTTGTAATAGG - Intergenic
1084557301 11:69882757-69882779 CCTGTTGCCTCCTGAGTGGTAGG + Intergenic
1085035326 11:73296599-73296621 GCTGCTGCCACCTGTGTATTCGG + Exonic
1085521624 11:77142586-77142608 TCTCTTCCCCCTTGTGTGGTTGG + Intronic
1087098701 11:94345237-94345259 TCTTTTGCCCACTTTTTAGTTGG - Intergenic
1087907524 11:103716482-103716504 GCTGCTGCCACCTGTTTAGTGGG + Intergenic
1089081487 11:115779888-115779910 TCTCTTGCCTCCTGAGTAGCTGG + Intergenic
1092246351 12:6866474-6866496 TTTGTTTGCCCCTGTGTGGTTGG + Exonic
1092450262 12:8594992-8595014 TCTCTTGCCTCCTGAGTAGCTGG - Intergenic
1092740600 12:11625572-11625594 TCTTTTGCCCACTTTTTAGTTGG - Intergenic
1096968235 12:55645933-55645955 TCTTTTGCCCACTTTTTAGTAGG + Intergenic
1097193294 12:57230486-57230508 TCAGTTGCCCTCTCTGGAGTTGG + Intronic
1098109464 12:67107277-67107299 TCTGGTTTCCCCTGTGTATTAGG + Intergenic
1098361286 12:69656796-69656818 TCCCTTGACCCCTGTGTAGTAGG - Intronic
1100657721 12:96665141-96665163 TCTTTTGCCCACTGTTTAATGGG + Intronic
1102587234 12:113931935-113931957 TCTCGAGCTCCCTGTGTAGTTGG - Intronic
1104072582 12:125358767-125358789 GCTGTTTCCCCCTTTGTAGTTGG + Intronic
1105580965 13:21695535-21695557 TTTGTTGCTTTCTGTGTAGTTGG + Intronic
1106720320 13:32428783-32428805 CCTGTTGCCGCCTGAGAAGTGGG + Intergenic
1107389611 13:39950244-39950266 TCCTTTGCCCCCTGTTTAATGGG - Intergenic
1107576007 13:41723270-41723292 TCTGTTGCCCTGTGGGAAGTGGG + Intronic
1108305535 13:49128426-49128448 TTTGTTGCCCTCTGTGTTGTAGG + Intronic
1109501226 13:63238338-63238360 GCTGTTGCCACCTGAGCAGTAGG + Intergenic
1110372898 13:74759277-74759299 TCTATGGCCCCCTCTGCAGTGGG + Intergenic
1115629438 14:35229114-35229136 TCTTTTGCCCACTTTGTAATGGG + Intronic
1116214824 14:42000853-42000875 TCTATTGCCCACTTTGTAATTGG + Intergenic
1117333380 14:54736237-54736259 GATGTTGCCCACTGTGTAGAAGG + Intronic
1117670490 14:58101028-58101050 TCACCTGCCGCCTGTGTAGTGGG + Intronic
1118241972 14:64068927-64068949 TCTGGTGTCCACTGTGAAGTTGG - Intronic
1118611761 14:67546948-67546970 TCTGTTGGCCCCTGAGGAATAGG - Intronic
1121351861 14:93179838-93179860 TCACTTGCCCCCTCAGTAGTGGG - Intergenic
1121400450 14:93671851-93671873 TCCTTTGCCCACTGTTTAGTGGG - Intronic
1124505626 15:30270658-30270680 TCTGTTCTCCACTGTTTAGTGGG + Intergenic
1124737927 15:32267974-32267996 TCTGTTCTCCACTGTTTAGTGGG - Intergenic
1126854166 15:52821736-52821758 TCTCCTGCCTCCTGAGTAGTGGG - Intergenic
1127245624 15:57170437-57170459 TCTGCTTCCACCTATGTAGTAGG + Intronic
1131391777 15:92055268-92055290 TCTGTTGCCCACTTTTTAATGGG + Intronic
1133730369 16:8573326-8573348 TCTCTTGCCTCCTCTCTAGTAGG + Intronic
1133887344 16:9842820-9842842 TCTTATGCCTCCTGTGTAGCTGG - Intronic
1134427935 16:14170337-14170359 TCTCTTGCCTTCTGAGTAGTTGG - Intronic
1136068794 16:27775938-27775960 TCTGTTGCCCCCTCTGCAATGGG - Intronic
1138515190 16:57532086-57532108 TCAGTTTCCCCATGTGTAGAAGG + Intronic
1139578047 16:67854831-67854853 TCTCTTGCCTCCCGTGTAGCTGG - Intronic
1141838172 16:86556365-86556387 TCTGTTGCCTCCTGCGTAGGAGG - Intergenic
1142432011 16:90034061-90034083 TCTGTTGCCCTCTGAGAACTTGG + Intronic
1143200987 17:5112848-5112870 TCTCCTGCCTCCTGAGTAGTGGG - Intronic
1143278485 17:5732233-5732255 GCTGTTGCTCCCGGTGGAGTAGG + Intergenic
1143463820 17:7122105-7122127 TCTGTTGCCCAGTCTGCAGTAGG - Intergenic
1143956425 17:10673642-10673664 TCTGTTGGCCCTAGTGCAGTAGG - Exonic
1146158605 17:30546416-30546438 TCTTTTGCCCATTTTGTAGTGGG + Intergenic
1148956299 17:51356388-51356410 TCTGTTCACCCTTTTGTAGTTGG + Intergenic
1149025569 17:52023791-52023813 TCTGTTGCCCACTTTTTAATGGG - Intronic
1149883602 17:60317699-60317721 TCTTTAGCCTCCTGTGTAGCTGG - Intronic
1152022649 17:77788751-77788773 TCTGTTTCCACCTGGGTAGTTGG - Intergenic
1152365910 17:79856157-79856179 TCAGTTTCCCCCTCTGAAGTGGG - Intergenic
1153731208 18:8013693-8013715 TCTGTTGGCCACTGTGAAGGAGG + Intronic
1155814490 18:30288069-30288091 TCTGTTGCCTCTTATGTATTTGG + Intergenic
1156907870 18:42376265-42376287 TCTTTTGCCCACTTTTTAGTGGG + Intergenic
1157033017 18:43936709-43936731 TCTGTTGCCACCTATGTAAACGG + Intergenic
1157232067 18:45926702-45926724 TCTCCTGCCTCCTGAGTAGTTGG - Intronic
1157273624 18:46294824-46294846 TCTGTTGCGCCCTTGGTGGTGGG + Intergenic
1157796206 18:50578040-50578062 TCTGTTGAACCCTGGGCAGTCGG - Intronic
1158296641 18:56003737-56003759 TCTCTTGCCCCGTCTGAAGTTGG + Intergenic
1158630463 18:59109550-59109572 TCTGTTGCCTCCGGAGTAATCGG + Intergenic
1160322828 18:77912365-77912387 TATGTTGCCCTCTGTATACTGGG - Intergenic
1160479635 18:79226912-79226934 TGTGTTGGGCCCTGTGTACTAGG + Intronic
1161262982 19:3347761-3347783 TCTCCTGCCCCCTGAGTAGCTGG - Intergenic
1161558470 19:4957654-4957676 TCTCTTCCCCCCTGTGCTGTGGG + Intronic
1162016939 19:7851192-7851214 TCTGTAGCCGCCTGTGTTGGGGG - Intronic
1163143426 19:15364947-15364969 TCTGTTGCCCTTTGGGAAGTCGG - Intronic
1163162568 19:15473878-15473900 TCTTTTGCCCGCTTTTTAGTGGG - Intronic
1164539975 19:29115103-29115125 TCTGTTGCCTCCAGGGTCGTAGG + Intergenic
1165491333 19:36124915-36124937 CCTGTTGCCCACTTTGTAATGGG + Intronic
1166128415 19:40730677-40730699 TCTTCTGCCCCCTGAGTAGCTGG + Intronic
1166531718 19:43546860-43546882 TCTGATGCCCCCTGTCCAGTGGG - Intronic
925018237 2:547701-547723 GCTGTCCCTCCCTGTGTAGTGGG - Intergenic
925018248 2:547758-547780 GCTGTTCCTCCCTGGGTAGTGGG - Intergenic
931006165 2:57851691-57851713 TCTTTTGCCCACTTTGTAATTGG - Intergenic
932636098 2:73389259-73389281 TCTTTTGCCCGCTTTTTAGTGGG + Intronic
935033995 2:99350579-99350601 TCTTTTGCCCATTGTTTAGTTGG + Intronic
935139558 2:100340602-100340624 TCTGCAGCCCCGTTTGTAGTCGG + Intergenic
935390782 2:102550687-102550709 TCTGTTCCCCTATGTGTAGAAGG - Intergenic
937385721 2:121430275-121430297 GCTGTTGCTCCCCATGTAGTTGG - Intronic
938005426 2:127786566-127786588 GCTGTAGCCTCCTGTGTAGCTGG - Intronic
942944909 2:181661500-181661522 TCTGTTGCCCTCATTGCAGTGGG - Intronic
944522816 2:200588763-200588785 TCTGTTGCCTCCTGAGTAGCTGG + Intronic
944910305 2:204304534-204304556 TCTGTTGCAGCCTGTGCAGGAGG - Intergenic
1169538275 20:6570839-6570861 TCTTTTGCCCACTGTTTAATGGG - Intergenic
1175229719 20:57466043-57466065 TCAGTTTCCCCCTGTGAAATGGG - Intergenic
1175264082 20:57692178-57692200 TACGATGCCCCCTGTGTAGTGGG + Intronic
1175347063 20:58287392-58287414 TCTTTTCCCTCCTGTGCAGTGGG + Intergenic
1177040239 21:16099924-16099946 TCCTTTGCCCACTTTGTAGTAGG + Intergenic
1181431242 22:22882999-22883021 TCTGTTTCCTCCTCAGTAGTGGG + Intronic
1182287944 22:29259151-29259173 TCAGTTTCCCTCTGTGAAGTGGG + Exonic
1182378312 22:29865259-29865281 TCTTTTGCCCACTTTCTAGTTGG + Intergenic
1184816395 22:46874896-46874918 TCCTTTGCCCCCTGTTTAATGGG + Intronic
949928472 3:9059995-9060017 TCTGGTGGCCCCAGTGCAGTTGG - Intronic
951629758 3:24706791-24706813 TCTTTTTCCCCCTATGTAGGTGG + Intergenic
952494823 3:33906736-33906758 ACTGTAGCCCCCTGTGAAGTGGG + Intergenic
954501410 3:51020291-51020313 TCTTTTGCCCACTTTTTAGTGGG + Intronic
954936031 3:54328162-54328184 TATGTTCCCACCTGTGTGGTTGG + Intronic
956973720 3:74555972-74555994 TCTTTTGCCCATTTTGTAGTGGG + Intergenic
957509949 3:81174666-81174688 TCAATTGCCCCCTGTGAACTGGG + Intergenic
957689252 3:83546132-83546154 TCTGTTGCCTGGTGTGTAGGTGG + Intergenic
960865545 3:122195668-122195690 TCAGTTTCCCCATGTGTACTGGG - Intronic
961747413 3:129073501-129073523 TCTTCTGCCCCCTGAGTAGCTGG + Intergenic
962086890 3:132200735-132200757 TCAGTTGCCCCCTTTGGAGAGGG - Intronic
962336489 3:134536229-134536251 TCTGTTGCCCCCAGTTGAGTAGG + Intronic
962999186 3:140661280-140661302 TCTGTTGCCCACTTTTTAATGGG - Intergenic
963279474 3:143368239-143368261 TCTGTTGCTCCCTCTCTAGAGGG - Intronic
963947566 3:151162885-151162907 TCTGTTTCCCCGTGTCTGGTTGG + Intronic
965880126 3:173379288-173379310 TCTTTTGCCCCCTTTTTAATGGG + Intergenic
966507219 3:180719273-180719295 TCTGTTGCCCACTGCCTGGTTGG - Intronic
969383026 4:6819424-6819446 TCTTTTGCCCACTTTTTAGTGGG - Intronic
970672789 4:18415567-18415589 TTACTGGCCCCCTGTGTAGTAGG + Intergenic
972530690 4:39958721-39958743 TCTTGTGCCTCCTGAGTAGTTGG + Intronic
972772679 4:42212485-42212507 TATGTTGCCTCCATTGTAGTTGG + Intergenic
973553395 4:52057643-52057665 TCTGTTTCCCTCTGTTTAGGAGG - Intronic
975344482 4:73278187-73278209 TCTGTTGCCCACTTTTTAATGGG + Intergenic
975421631 4:74171165-74171187 TCTTTTGCCCATTGTTTAGTAGG - Intronic
976551378 4:86399426-86399448 TCTTTTGCCCACTTTTTAGTAGG + Intronic
978598603 4:110404847-110404869 TCTGTTGCCACCTGAGTGGTTGG - Intronic
980512962 4:133817712-133817734 TCTGTTGCCCACTTTTTATTGGG - Intergenic
983527600 4:168775364-168775386 TCTGTTGCCCATTGTTTAATTGG + Intronic
984679486 4:182590738-182590760 TCTCCTGCCCCCCGAGTAGTTGG - Intronic
984973055 4:185207745-185207767 TCAGTTCCCCGCTGTGTAGATGG + Intronic
986311808 5:6556809-6556831 TGTGTTGCCTCCTATGAAGTTGG + Intergenic
989019021 5:36978418-36978440 TCTTTTGCCCACTTTTTAGTGGG + Intronic
989243902 5:39231814-39231836 TCAGCTGCACCCTGTCTAGTTGG + Intronic
994092744 5:95823367-95823389 GCTGTTGCCCCCTTTGTATAGGG + Intronic
994292097 5:98040154-98040176 TCTGTTGCCCACTTTTTAATGGG - Intergenic
994433359 5:99696658-99696680 TCTTTTGCCCACTGTTTAATGGG + Intergenic
994803863 5:104417611-104417633 TCTGTTGCCCACTTTTTAATGGG - Intergenic
997287283 5:132689647-132689669 TCTGTTACTGCCTGTGTTGTCGG - Intergenic
997649701 5:135507223-135507245 ACTGTTACTACCTGTGTAGTTGG + Intergenic
999028768 5:148266100-148266122 TCCTTTGCCCACTGTTTAGTTGG - Intergenic
1001025361 5:168219728-168219750 TGTGTTAACCCCTGTGTACTTGG + Intronic
1001973943 5:175981401-175981423 TCTTTTGCTACCTGTGTTGTTGG - Intronic
1002243489 5:177862378-177862400 TCTTTTGCTACCTGTGTTGTTGG + Intergenic
1004127347 6:12886658-12886680 TCTGTTGGGTCCTGTGTTGTTGG - Intronic
1005193079 6:23250120-23250142 TCTTGTGACCACTGTGTAGTGGG + Intergenic
1006033107 6:31192141-31192163 TCTCTTGCCTCCTGAGTAGCAGG + Intergenic
1006130099 6:31863879-31863901 TCAGTTTCCTCCTGTGAAGTGGG + Intronic
1007217753 6:40253720-40253742 TCTGCTGCCCCCTGTGCTATGGG + Intergenic
1008885377 6:56426670-56426692 TCTTTTGCCTACTGTGTAATGGG - Intergenic
1009365615 6:62855701-62855723 TCTCCTCCCCCCTGTGTATTAGG - Intergenic
1010687891 6:78873511-78873533 TCTGTTGCCCAGTATGGAGTAGG + Intronic
1010819809 6:80400390-80400412 TCTGTTGCCCACTTTGTAATGGG - Intergenic
1011561781 6:88626068-88626090 TCTGTTTCCCTCTGTGAAATGGG - Intronic
1013248710 6:108313235-108313257 TCTGTGGCCCCCAGTATAGTAGG - Intronic
1014361055 6:120474647-120474669 TCCGTGGCTTCCTGTGTAGTTGG - Intergenic
1016750694 6:147628176-147628198 TCTCTTGTCCCCTGTCTATTTGG - Intronic
1017908066 6:158770312-158770334 TCTGTGGCGCCTTGTGTAATCGG + Intronic
1020804711 7:12774566-12774588 TCTGTTGCCCACTTTTTAATAGG - Intergenic
1023478448 7:40606391-40606413 CCTGTTTCCATCTGTGTAGTGGG - Intronic
1027174956 7:75897380-75897402 TCAGTTTCCCCATCTGTAGTTGG + Intergenic
1027926629 7:84473501-84473523 TCTCTTGCCTCCTGAGTAGCTGG + Intronic
1028795745 7:94901153-94901175 TTTGGTGGACCCTGTGTAGTAGG - Intergenic
1029638858 7:101805386-101805408 TCAGTTTCCCCCTGTGTAAAAGG + Intergenic
1031061770 7:117059945-117059967 TCTGTTGCCCAGGGTGAAGTGGG - Intronic
1033363924 7:140657065-140657087 TCTGTTGCCCCCCTTGGACTTGG - Intronic
1038429892 8:27491582-27491604 TCTGCTGCCTCCTGTCTAATGGG + Intronic
1039443606 8:37612744-37612766 TCAGTTGGCCCCAGTGTCGTGGG + Intergenic
1039970791 8:42320173-42320195 TCTGTTTTCCCCTGTGTACTTGG + Intronic
1040964255 8:53068259-53068281 TCTTTTGCCCACTTTTTAGTGGG + Intergenic
1043344066 8:79278546-79278568 TCTTTTGCCCACTTTTTAGTGGG - Intergenic
1044959943 8:97520632-97520654 TCTTTTGCCCACTTTGTAATGGG - Intergenic
1048808133 8:138260113-138260135 TCTGCTGACCCCTGAGTAGGAGG - Intronic
1049166569 8:141129276-141129298 TGTGTTGTCCCCTGAGTAGTGGG + Intronic
1050878293 9:10668797-10668819 TCTGTTGCCCACTTTCTAATGGG + Intergenic
1051413951 9:16819546-16819568 TCTGCTGCCTCCTGAGTAGCTGG - Intronic
1052528543 9:29653311-29653333 TCTGTAGATCACTGTGTAGTAGG + Intergenic
1055637541 9:78293666-78293688 TCTGCTGCCCTTTTTGTAGTTGG - Intergenic
1056223980 9:84477455-84477477 TTTGTTGCCCTCTCTGTATTTGG - Intergenic
1056885370 9:90437610-90437632 TCTGTTGTCCCCTGTGTCTTTGG - Intergenic
1061708399 9:132470523-132470545 TGTGGTGCCCCCTGGGCAGTAGG + Intronic
1061890795 9:133618059-133618081 TCTGTGGGGCCGTGTGTAGTAGG + Intergenic
1186400339 X:9252656-9252678 TCTGCAGCCCCCTGAGTTGTTGG + Intergenic
1188712709 X:33421171-33421193 TCTTTTGCCCACTTTGTAATGGG - Intergenic
1191054397 X:56227457-56227479 TCTTTTGCCTCCTGAGTAGCTGG + Intergenic
1199677196 X:150198688-150198710 TCAGGTGCCTCCTGTGTAGCAGG + Intergenic
1200160344 X:154004579-154004601 TCTGTTGTCCCATCTGTCGTTGG - Intergenic