ID: 900218938

View in Genome Browser
Species Human (GRCh38)
Location 1:1496719-1496741
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 2, 1: 0, 2: 0, 3: 7, 4: 89}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900218933_900218938 5 Left 900218933 1:1496691-1496713 CCACACTCGCTGCCTGAATTCTG 0: 2
1: 0
2: 2
3: 15
4: 166
Right 900218938 1:1496719-1496741 AGAGCGTGGTACCCACTGCCTGG 0: 2
1: 0
2: 0
3: 7
4: 89
900218936_900218938 -7 Left 900218936 1:1496703-1496725 CCTGAATTCTGGGAGCAGAGCGT 0: 2
1: 0
2: 2
3: 19
4: 163
Right 900218938 1:1496719-1496741 AGAGCGTGGTACCCACTGCCTGG 0: 2
1: 0
2: 0
3: 7
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900209101 1:1444801-1444823 AGAGCGTGGTACCCACTGCCTGG + Intergenic
900218938 1:1496719-1496741 AGAGCGTGGTACCCACTGCCTGG + Intronic
903293140 1:22327141-22327163 AGGGCCTGGTTCCCACTTCCTGG + Intergenic
904402265 1:30264519-30264541 AGAGCGTGGATCCCTCTGCATGG - Intergenic
905108093 1:35575985-35576007 AGAGGCTGCTACCCAATGCCTGG - Intronic
905653381 1:39671360-39671382 AGAGTGTGGATCCCAGTGCCTGG + Intronic
908466755 1:64403533-64403555 AGTATGTGGCACCCACTGCCTGG + Intergenic
910958728 1:92737643-92737665 GGAGAGTGGTACCTACTACCAGG - Intronic
920502844 1:206496372-206496394 AGAGTGTGGCAGCAACTGCCTGG + Exonic
923034590 1:230276679-230276701 AGAGAGGGGCTCCCACTGCCAGG - Intronic
1070427488 10:76303842-76303864 CGAGCGTGTTAGCCGCTGCCTGG - Intronic
1075594455 10:123718149-123718171 AGAGCCTTTCACCCACTGCCTGG - Intronic
1076589853 10:131575402-131575424 AGACTGTGGGACCCACTGGCTGG - Intergenic
1083303734 11:61752495-61752517 GGAGCGTGGTGCCCGCGGCCGGG + Intergenic
1085719101 11:78897550-78897572 AGAGCATGGTTCCCTCTGCTTGG - Intronic
1089025258 11:115262604-115262626 AGAGCTTGGTACGCAATGCCTGG - Intronic
1089634683 11:119804582-119804604 AGAGCCCAGTCCCCACTGCCTGG - Intergenic
1098521731 12:71440629-71440651 AGAGCCTGGTACCCAAAGGCAGG + Intronic
1104938483 12:132380216-132380238 AGAGCGTGGTCCTCCCTTCCAGG - Intergenic
1105854094 13:24360379-24360401 AAGGCCTGGTCCCCACTGCCAGG - Intergenic
1109829598 13:67769843-67769865 AGGGCGTGGTACCCGCAGCTTGG + Intergenic
1113912745 13:113851932-113851954 CAAGCGTGGTGCCCACTGCACGG + Intronic
1120060403 14:79975898-79975920 AGAGCGTGATCTCCACTACCAGG - Intergenic
1122842891 14:104475398-104475420 AAAGCCTGGTCTCCACTGCCAGG - Intronic
1124406108 15:29393385-29393407 TGAGCCTGGTGCCCACTGCAAGG - Intronic
1126930570 15:53644994-53645016 AGTGCGTGAAACCCACTGACTGG + Intronic
1129090396 15:73143564-73143586 AGAGCCTGGGAACCACTGACAGG - Intronic
1132398887 15:101492864-101492886 AGAGCCTGGCACCCAGAGCCTGG + Intronic
1135615026 16:23903711-23903733 AGAAAGTGGTTCCCACTGCCTGG + Intronic
1136298010 16:29314612-29314634 AGAGGGTGGTAGCCCATGCCAGG - Intergenic
1142389737 16:89791332-89791354 ACAGCATGGTCCCCACTCCCAGG + Intronic
1143387836 17:6542674-6542696 AGAGCGTCTAGCCCACTGCCTGG + Intronic
1143437296 17:6938829-6938851 AGAGCCTGTTAACCACGGCCAGG + Intronic
1145983488 17:29028497-29028519 AGAGCCTTGTTCACACTGCCAGG + Intronic
1148665427 17:49371275-49371297 AGAGCTTGGCACCAACTACCAGG - Intronic
1151544930 17:74786924-74786946 GGGGTGTGGTACCCCCTGCCTGG - Intronic
1152466555 17:80469863-80469885 GGAGCGTGCCACCCACAGCCCGG - Exonic
1152542188 17:80982002-80982024 GGAGCGTGGGAGCCCCTGCCTGG + Intergenic
1152542703 17:80984363-80984385 TGAGCGTGGATCCCACTGTCAGG + Intergenic
1152829439 17:82488121-82488143 GGAGCGTGGCACACACAGCCTGG + Exonic
1153955344 18:10091281-10091303 AGAGCGGGGTCCCCACCCCCGGG + Intergenic
1154166480 18:12018380-12018402 AGAGCGTGGCACACAGTGGCTGG - Intronic
1155984408 18:32214866-32214888 AGAGTGTGGTCCTCCCTGCCAGG + Intronic
1159934953 18:74357215-74357237 ACAGTGTTGTCCCCACTGCCTGG - Exonic
1160030850 18:75258223-75258245 TGCACGTGGTACCCACTGTCAGG + Intronic
1160574862 18:79847481-79847503 GGAGCGTGGTCCGCACTGCCGGG - Intergenic
1161498407 19:4599515-4599537 AGATGGTGGTACCCATTTCCTGG + Intergenic
1161658170 19:5528880-5528902 AGAGAGGGGTCCACACTGCCTGG + Intergenic
1163631600 19:18420367-18420389 AGCGCCTGGTACCCACGGCCTGG - Intronic
925972971 2:9120430-9120452 AGAGGGTGGGACACACAGCCTGG - Intergenic
926795111 2:16612579-16612601 AGAGCCTGCCACCCACTGCTAGG + Intronic
932494629 2:72140262-72140284 AGAGGGAGGTGCCCACTCCCAGG + Intronic
935813051 2:106818234-106818256 GGACCATGGTAACCACTGCCTGG - Intronic
937677866 2:124611388-124611410 AGGACGTGGCACCCAATGCCAGG - Intronic
943027674 2:182649211-182649233 CAATCTTGGTACCCACTGCCTGG + Intergenic
944122124 2:196251586-196251608 AGAGGGTGCTACCATCTGCCTGG + Intronic
946170252 2:217891031-217891053 AGAGCCTGGTCCGCACTGCAGGG + Exonic
1174189765 20:48731964-48731986 AGAGGGTGGGACCCTCAGCCAGG + Intronic
1174858766 20:54070510-54070532 AGTGCGTGCTGCCCAGTGCCTGG + Exonic
1176013397 20:62913152-62913174 AGAGCGTGGAGGCCACGGCCAGG - Intronic
1179644874 21:42769863-42769885 AGAGCCTGCTCCCCACAGCCTGG + Intronic
1182088062 22:27575025-27575047 AGAGAGTGGCGGCCACTGCCTGG - Intergenic
1183958730 22:41398046-41398068 AGAACCCGATACCCACTGCCTGG - Exonic
949776664 3:7640435-7640457 AGAGCATGGTAGCCAATTCCAGG - Intronic
953463856 3:43102974-43102996 ACAGCTGGGTACCCTCTGCCTGG - Intronic
953948143 3:47166113-47166135 AGTGCCTGGTACACAATGCCAGG - Intergenic
954398316 3:50304833-50304855 TGAGTGTGGAACCCAGTGCCTGG + Intronic
957537967 3:81531113-81531135 AGGCCATGGCACCCACTGCCTGG + Intronic
959937427 3:112043803-112043825 GGCGAGTGGTACCCACAGCCAGG - Intronic
973698402 4:53513406-53513428 AAAGCATGGAACCCACAGCCTGG - Intronic
978493329 4:109332705-109332727 AGCCCATTGTACCCACTGCCAGG - Intergenic
983589837 4:169396441-169396463 AGAACATGGTAGCCTCTGCCAGG + Intronic
984690331 4:182718975-182718997 GGAGCTTGGTAACGACTGCCAGG - Intronic
984924843 4:184797594-184797616 TGAGCGTGGCTCCCACAGCCTGG + Intronic
985824090 5:2180173-2180195 AGAGGGTGGCACCCACCTCCCGG + Intergenic
986312172 5:6559190-6559212 AGAACGTGTCACCCAATGCCAGG + Intergenic
990086756 5:51987922-51987944 AGAGCATGGTACACAATGCCAGG - Intergenic
999071776 5:148750733-148750755 TGAGCGTGGAATCCACTGGCTGG - Intergenic
1005497646 6:26402433-26402455 AGAGCCTGGTTCACAATGCCTGG + Intronic
1005954662 6:30655554-30655576 AGAGCATGGCAGCCACTGTCAGG + Exonic
1006358674 6:33575477-33575499 AGGGCCTGGTCCCGACTGCCTGG - Intronic
1006926435 6:37658084-37658106 AGAGGGTGGTACACACCGCCTGG + Intronic
1009624813 6:66126101-66126123 AGATGCTGGTACCCACTGCTAGG - Intergenic
1015460804 6:133488414-133488436 AGCCTGTGGTAACCACTGCCTGG - Intronic
1021554757 7:21908086-21908108 AGAGCCTGGTGCCAACTCCCAGG + Intronic
1022440760 7:30430932-30430954 AGAACTTGGTGCCCACTTCCTGG - Intronic
1029582614 7:101447547-101447569 ATGGCGTGGAAACCACTGCCGGG - Intronic
1038672741 8:29595578-29595600 AGGGCATGGTACTCACTGTCTGG - Intergenic
1045159571 8:99523380-99523402 TGCCCGTGGTAACCACTGCCTGG - Intronic
1046745218 8:117868883-117868905 AGGGCCTGATACCCACTGCCAGG + Intronic
1056968103 9:91180745-91180767 ACAGAGTGGGTCCCACTGCCTGG + Intergenic
1060036307 9:120258954-120258976 AGAGTGTGGTACCCAAGACCAGG + Intergenic
1062322923 9:135999112-135999134 AGAGAGAGGGTCCCACTGCCTGG - Intergenic
1186417357 X:9395298-9395320 AGAAAATGATACCCACTGCCCGG + Intergenic
1187618196 X:21021029-21021051 ACATTGTGGTAACCACTGCCTGG - Intergenic
1193782543 X:85721297-85721319 ATAGGGTGGTACCCACTCCTTGG - Intergenic
1199184335 X:144897583-144897605 AGAGCCTGCTACTCACTGCACGG - Intergenic
1200142277 X:153908185-153908207 AGAGGGGGGTCCCCACTTCCGGG - Intronic