ID: 900221457

View in Genome Browser
Species Human (GRCh38)
Location 1:1511610-1511632
Sequence CCCTCCCGCCCAAGACCCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 189}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900221457_900221467 7 Left 900221457 1:1511610-1511632 CCCCGGGGTCTTGGGCGGGAGGG 0: 1
1: 0
2: 1
3: 21
4: 189
Right 900221467 1:1511640-1511662 GGCTGCGGAGACACCGAGGAGGG 0: 1
1: 0
2: 0
3: 20
4: 191
900221457_900221463 -8 Left 900221457 1:1511610-1511632 CCCCGGGGTCTTGGGCGGGAGGG 0: 1
1: 0
2: 1
3: 21
4: 189
Right 900221463 1:1511625-1511647 CGGGAGGGCCGTGCGGGCTGCGG 0: 1
1: 0
2: 1
3: 35
4: 358
900221457_900221469 11 Left 900221457 1:1511610-1511632 CCCCGGGGTCTTGGGCGGGAGGG 0: 1
1: 0
2: 1
3: 21
4: 189
Right 900221469 1:1511644-1511666 GCGGAGACACCGAGGAGGGGAGG 0: 1
1: 0
2: 0
3: 19
4: 422
900221457_900221465 3 Left 900221457 1:1511610-1511632 CCCCGGGGTCTTGGGCGGGAGGG 0: 1
1: 0
2: 1
3: 21
4: 189
Right 900221465 1:1511636-1511658 TGCGGGCTGCGGAGACACCGAGG 0: 1
1: 0
2: 0
3: 9
4: 138
900221457_900221466 6 Left 900221457 1:1511610-1511632 CCCCGGGGTCTTGGGCGGGAGGG 0: 1
1: 0
2: 1
3: 21
4: 189
Right 900221466 1:1511639-1511661 GGGCTGCGGAGACACCGAGGAGG 0: 1
1: 0
2: 0
3: 18
4: 232
900221457_900221468 8 Left 900221457 1:1511610-1511632 CCCCGGGGTCTTGGGCGGGAGGG 0: 1
1: 0
2: 1
3: 21
4: 189
Right 900221468 1:1511641-1511663 GCTGCGGAGACACCGAGGAGGGG 0: 1
1: 0
2: 0
3: 13
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900221457 Original CRISPR CCCTCCCGCCCAAGACCCCG GGG (reversed) Intergenic
900221457 1:1511610-1511632 CCCTCCCGCCCAAGACCCCGGGG - Intergenic
900369303 1:2324278-2324300 CCGTCCTGCCCATGGCCCCGAGG - Intronic
900626728 1:3611771-3611793 GAGTCCCGCCCCAGACCCCGCGG + Intergenic
900695180 1:4005278-4005300 CCCTGCCAGCCAGGACCCCGGGG + Intergenic
900988628 1:6087344-6087366 CCCTCCCACCCAGGAGCCTGGGG - Intronic
902601213 1:17540858-17540880 CCCTCTCTCCCCAGAACCCGAGG - Intronic
902621043 1:17651346-17651368 GCCTCCAGCCCAAGGCCCCAGGG - Intronic
903172525 1:21563013-21563035 CCCTCACGCCCCAGTCCCCATGG + Intronic
905183580 1:36180648-36180670 CCCTCCCCCCAAAGCCCCCTGGG + Exonic
905797850 1:40825571-40825593 CCCTCCAGCCCCAGACCTGGAGG - Intronic
908354376 1:63316878-63316900 CCTTCCTGCCCAAGACCACTGGG - Intergenic
913453550 1:119008388-119008410 GTCTCCCGCCCACTACCCCGCGG - Intergenic
918048291 1:180954213-180954235 CCCGCCCGCGCGAGGCCCCGCGG - Intergenic
920310286 1:205044419-205044441 CCCTCTAGCCCCAGACCCCTGGG + Intronic
921217494 1:212950433-212950455 CCCTCCCGCCAGAGAACCCCTGG + Intergenic
1064110039 10:12530642-12530664 CGCTGCCTCCCCAGACCCCGAGG - Intronic
1065211337 10:23406249-23406271 CCCTCCAGCCAAAGACCACCAGG - Intergenic
1067039294 10:42940490-42940512 CCCCCCAGCCCAAGACCCCAAGG - Intergenic
1067515075 10:46932649-46932671 CCCACCCCACCAAGACCCAGAGG - Intronic
1069628101 10:69880573-69880595 CCCATCCCCCCAACACCCCGAGG - Intronic
1069867343 10:71511949-71511971 CCGCCCAGCCCAAAACCCCGAGG - Intronic
1072660566 10:97361112-97361134 CCCACCCGCCTGAGAGCCCGTGG - Intronic
1076392111 10:130110834-130110856 CCCTTCCGCACAAGGCCCTGGGG + Intergenic
1076885744 10:133261680-133261702 CCCCCCCGCCCAAGAGTCTGGGG - Intergenic
1077107876 11:849777-849799 CCCTCCCGGCCAATCCCCGGCGG - Intronic
1077124225 11:925373-925395 CCCTCCCGCCCCGGCCCCCGCGG + Intronic
1077976285 11:7251930-7251952 CCGTCCCTCCCCAGACACCGAGG - Exonic
1078431229 11:11290242-11290264 CCCTCTCCTCCATGACCCCGGGG - Intronic
1081773878 11:45665141-45665163 CCCGCCCGCCCCGGAGCCCGCGG + Intronic
1083632742 11:64104150-64104172 CGCTGCCGCCCAAGACCCTCTGG - Exonic
1085295809 11:75431031-75431053 CTCTCCCGCTACAGACCCCGGGG - Intergenic
1085456927 11:76670685-76670707 CCACCCCGCGCCAGACCCCGGGG + Intronic
1085527679 11:77173662-77173684 CCTTCCCTCCCCAGATCCCGAGG - Intronic
1085597085 11:77820350-77820372 CCCCACTGCCCAAGACCCCGGGG + Intronic
1086187140 11:84032095-84032117 CCCTATTCCCCAAGACCCCGAGG + Intronic
1090409282 11:126496592-126496614 CCCCACCTCCCAAGACCCTGTGG - Intronic
1091225917 11:133956488-133956510 CCCTCCAGCCCACGGCCCCCAGG + Intronic
1091393433 12:139385-139407 CCCTCCCTCCCAGGACGCCCAGG - Intronic
1092020796 12:5200730-5200752 CCTCCCCGCCCCCGACCCCGTGG - Intergenic
1095982466 12:47981192-47981214 TCCTCCCACCCTAGACCCAGCGG + Intronic
1096220888 12:49827808-49827830 CCCTACCGCCCCAGGCCACGGGG + Intronic
1096435873 12:51591009-51591031 CCCGCCCGCCCGCGCCCCCGCGG - Intronic
1100288250 12:93188168-93188190 CCCTCCAGCCAAAGACCACCAGG - Intergenic
1103874425 12:124116212-124116234 CCCTCACCCCCAAGACCCCAAGG - Intronic
1104802779 12:131565942-131565964 CCGTCCCACCCACGACGCCGCGG - Intergenic
1104843060 12:131833823-131833845 CCCTCCCGCCCAGGGCACCCTGG - Intronic
1106242031 13:27920351-27920373 CCCCCTCGCCGACGACCCCGCGG + Exonic
1107654244 13:42574951-42574973 CCTTCCCGCCCACCACCCGGCGG + Intronic
1108484529 13:50910368-50910390 CCCTCCCACCCGAGCCACCGGGG - Intronic
1110648315 13:77915477-77915499 TCATCCAGCCCAAGACCCTGTGG - Intronic
1112183587 13:97108013-97108035 CTCTCCTGCCCAAGCCCTCGGGG + Intergenic
1113328654 13:109308144-109308166 CCCTGCCTCACAAGACCCCATGG - Intergenic
1113655086 13:112062998-112063020 GGCTCCGGCCCGAGACCCCGCGG - Intergenic
1113887634 13:113669326-113669348 CCCTCCTGTCCAGGCCCCCGTGG - Intronic
1117028990 14:51651018-51651040 CGCCCCCTCCCCAGACCCCGAGG + Intronic
1118404943 14:65413249-65413271 CAGCCCAGCCCAAGACCCCGAGG - Intronic
1120164339 14:81180004-81180026 CCCTCCCACCCAAAAACCCTAGG + Exonic
1122080747 14:99265612-99265634 CCGTCCGGCCCAAGACTTCGAGG + Intronic
1122162268 14:99793235-99793257 CCCTCCCGGCCCGGGCCCCGCGG + Intronic
1122689076 14:103523025-103523047 GTCCCCCGCCCAAGACCTCGAGG + Exonic
1126009588 15:44289401-44289423 ACATCCCGCCCCAGACCCCGGGG - Intronic
1127988843 15:64096186-64096208 CCCTCCCGCCTGCTACCCCGAGG - Intronic
1129389227 15:75212349-75212371 CCCTCTCTCCTGAGACCCCGTGG + Intergenic
1132093072 15:98961111-98961133 CCATCTCTCCCAGGACCCCGGGG + Exonic
1132520053 16:382730-382752 CCCTCCCACCCACGACGCGGCGG - Intronic
1132808384 16:1786340-1786362 CCCTGCAGCCCCAGACCCGGGGG - Intronic
1132852171 16:2029704-2029726 CCCACCCGCCCACGACCCCTGGG + Exonic
1132872404 16:2121781-2121803 CCCTGCTCCCCAGGACCCCGAGG + Intronic
1133038159 16:3046203-3046225 TCCTTCCCCCCAGGACCCCGTGG - Intergenic
1133437367 16:5791455-5791477 CCCTCCTGGCCAAGATCCCAGGG - Intergenic
1134763017 16:16730773-16730795 CCCTCCAGCCAAAGACCTCCAGG + Intergenic
1134983035 16:18628376-18628398 CCCTCCAGCCAAAGACCTCCAGG - Intergenic
1137609589 16:49809812-49809834 CCCTCCAGCCCCAGACCCCCTGG - Intronic
1137618147 16:49858718-49858740 CCCCCCCCCCCACGCCCCCGCGG + Intergenic
1141731022 16:85822894-85822916 CCCTCCCACCCCAAACCCCTCGG - Intergenic
1142870186 17:2814836-2814858 CCCTCCCCCCCAACACCCCAGGG - Intronic
1144816992 17:18041199-18041221 CCCCCCCGCCCCACCCCCCGGGG + Intronic
1146615922 17:34357321-34357343 CACTCCCACCCTAGACCCTGAGG - Intronic
1146968927 17:37056637-37056659 CCCTCCCGACGAAGGCCACGGGG + Exonic
1147331228 17:39700464-39700486 CCCTCCCGCCCGAGGGCCCCAGG - Intronic
1151235828 17:72719298-72719320 CCCTGCCTCCCGAGGCCCCGTGG + Intronic
1152104240 17:78319398-78319420 CCCTCCTGCCCAAGCCTCCCAGG - Intergenic
1152251498 17:79215001-79215023 CACTCCTGCACAAGACCCAGCGG + Intronic
1152460782 17:80441356-80441378 CATTCCTGCCCAAGACCCCCTGG + Intergenic
1153233264 18:2961188-2961210 ACCTCCTGCCCAAGACCCTTTGG + Intronic
1156350206 18:36296930-36296952 CCCACCTCCCCAAGCCCCCGCGG + Intergenic
1160346408 18:78135826-78135848 CCGGCCAGCCCAAGACCCCCAGG + Intergenic
1160863830 19:1248786-1248808 CCCTCCCACCCCGCACCCCGGGG - Intronic
1161233323 19:3186349-3186371 CCCTGCCGCCCTGGACCCCCGGG + Intronic
1161473504 19:4472720-4472742 CCCTGCAGCCCAGGACCCCCAGG - Intronic
1161628409 19:5339756-5339778 CCCTCCCCCCGCAGCCCCCGGGG + Intronic
1161977936 19:7616407-7616429 CAGTCCTGCCCAAGACCCCTCGG - Intronic
1162084481 19:8240307-8240329 CACTCCCCCCAAAGACCCCAAGG - Intronic
1162289527 19:9768525-9768547 TCCTCCCCGCCAGGACCCCGAGG - Exonic
1163389513 19:17021891-17021913 CCCTCCCTCCCATGCCCCTGGGG + Intronic
1165132654 19:33642253-33642275 CCCACTCCCCCAGGACCCCGTGG + Intronic
1165148542 19:33748076-33748098 CCCTCCTGCCAAGGACCCAGGGG + Intronic
1165446925 19:35861620-35861642 CTCTCCCGCCCCAGATGCCGTGG + Exonic
1165461106 19:35944923-35944945 CCCGCCCGCCCCGGAGCCCGCGG + Exonic
1166354447 19:42218544-42218566 CCGTCACACCCAAGGCCCCGCGG - Intronic
1166373837 19:42316220-42316242 CCCTCCCCCCTCAGACCCAGGGG - Intronic
1166532679 19:43552402-43552424 CCCTCCCCCCTCAGACCCAGGGG + Intronic
1166647420 19:44542628-44542650 CCCCCCCTGCCAAGACCCAGTGG - Intergenic
1166808226 19:45499466-45499488 CCCTCCTCCCCAAAACCCCGAGG - Intronic
1167145376 19:47678465-47678487 CCATCCAGCCCAAGCCCGCGGGG - Intronic
1167145755 19:47680219-47680241 CCATCCAGCCCAAGCCCGCGGGG + Exonic
1167678728 19:50906515-50906537 CCCTCCTTCCCCAGACCCAGAGG - Exonic
1168494996 19:56840475-56840497 GCCGCAAGCCCAAGACCCCGCGG - Intronic
925389595 2:3486305-3486327 CCCTCCACCCCAGGGCCCCGAGG + Intergenic
925724411 2:6859417-6859439 CCCTCCCATCACAGACCCCGAGG + Intronic
925876232 2:8313246-8313268 CCCTCCTGCCCTAGACCCCCTGG + Intergenic
927652190 2:24919723-24919745 CTCTCCCGCCCCAGCCCGCGCGG - Exonic
927985673 2:27409139-27409161 CCCTCTCGGCCCTGACCCCGCGG + Intronic
932717699 2:74114290-74114312 CCCTCCCCCCCGAGTCCCCAAGG - Intergenic
934664431 2:96159691-96159713 CCCTCCAGCCAAAGACCACGAGG - Intergenic
934686426 2:96325264-96325286 CCTCCCCGCCCAAACCCCCGTGG - Intergenic
935013223 2:99155109-99155131 CGCGCGCGCCCAAGACCCCACGG - Intronic
937905984 2:127053069-127053091 CCCTCCTGCCCCACACCCTGAGG + Intronic
937974871 2:127576582-127576604 CCCTCCCTCCCAGGCTCCCGAGG + Exonic
941902136 2:170688815-170688837 CCCTCACCCCCAATACCCCGAGG + Intergenic
941978577 2:171431741-171431763 CACTCCCGCCCATGGCCCTGGGG - Intronic
947235241 2:227934739-227934761 CCCCCCCCCCCAATCCCCCGTGG - Intergenic
1171452591 20:25247046-25247068 CCCTTCAGCCCAAGACCACCAGG + Intergenic
1172834892 20:37866926-37866948 CCCACCCCCACAAGGCCCCGGGG - Intronic
1173250976 20:41364130-41364152 CCATCCCTCCCAAGACCACTTGG + Intronic
1173822140 20:46026344-46026366 CCCTCCCCACCAAGAACCCTGGG - Intronic
1175008444 20:55710626-55710648 CCCTCCCACCACAGACCCAGAGG + Intergenic
1179713741 21:43277168-43277190 CCCACCCTCCCAGGGCCCCGCGG + Intergenic
1179828571 21:43982018-43982040 CCCACCAGCCAAAGACCCAGAGG + Intronic
1179937534 21:44614615-44614637 CCCCCCAGCCCAACACCCCCAGG - Intronic
1180064520 21:45405669-45405691 CCCTCCCGGCCCGGACCCCGCGG - Intronic
1180188485 21:46151790-46151812 CCCTCCTTCCCGGGACCCCGGGG - Intronic
1181021754 22:20107173-20107195 CCCTCCTGACCCACACCCCGAGG - Intronic
1183309515 22:37101806-37101828 CCCTCCAGCCCAGTGCCCCGTGG + Intronic
1183429297 22:37756045-37756067 CCCTCCTGCCCCAGTGCCCGTGG - Intronic
1184176784 22:42793481-42793503 CCCTGCAGCCCAAGACCAAGGGG + Intergenic
1184387913 22:44186735-44186757 CCTTCCCTCCCATGACCCCTGGG - Intronic
1184657264 22:45948144-45948166 GCCTCCCGGCCGAGCCCCCGGGG - Intronic
952889641 3:38031375-38031397 CCATCCTGCCCAAGAACCCTGGG - Intergenic
953399537 3:42600818-42600840 CCCTCCCGCCCCGGGCCTCGCGG - Intronic
954121695 3:48503742-48503764 CCCTCCCGCCCATGTTCCAGGGG - Intronic
959703290 3:109317804-109317826 CCCTTCAGCCCAGGAGCCCGAGG + Intergenic
960586265 3:119323387-119323409 CCCCGCCGGCCCAGACCCCGCGG + Intronic
960869365 3:122233391-122233413 CCATCCAGCCAAAGACCCCCAGG - Intronic
964274507 3:154995286-154995308 CCCTCCCATCAAAGACCCAGAGG - Intergenic
965040340 3:163499313-163499335 CCCTCCCGCACAGGAGCCCACGG - Intergenic
965404145 3:168249576-168249598 CCCTCCCGCCCCAGCCCCTCCGG - Intergenic
966892465 3:184417344-184417366 CCCTGTCGCCCAAGGCCCAGAGG + Intronic
967107919 3:186268965-186268987 TCCTCCAGCCCAGGGCCCCGGGG - Intronic
967943290 3:194782880-194782902 CCCTCCAACCCAACACCCCTTGG + Intergenic
967989434 3:195120286-195120308 CCCCCCCGCCCCAGCCCCCATGG + Intronic
968092719 3:195908858-195908880 CCCTCCCCCGCAGGCCCCCGGGG + Intronic
968913727 4:3488168-3488190 CCTGCCAGCCCAAGACCCTGTGG - Intronic
968919843 4:3516849-3516871 CCTTCCTGCTCAGGACCCCGAGG + Intronic
969699940 4:8762423-8762445 CCCTCCAGCCACAGACCCCCGGG + Intergenic
971394530 4:26216019-26216041 CCCTATCGCCAAAGACCCCGGGG + Intronic
972739786 4:41878710-41878732 CCCTCCCATCCAAGAACCCCCGG + Intergenic
977614652 4:99074713-99074735 CCCTCCCCCCCAAGTCCCAGGGG + Intronic
983393879 4:167168808-167168830 CCCTCCCGCCACAGGCCCAGAGG + Intronic
985521593 5:376277-376299 CCCTCCTGCCCAACCCCCCAGGG - Intronic
985868619 5:2536361-2536383 CCCTCCAGCCCCAGACCCAGAGG - Intergenic
986706970 5:10460435-10460457 CCCTCCCAGCCAAGTCCCTGCGG - Intronic
991048192 5:62244930-62244952 CTCGCCCGCCCAAGACTCCTGGG - Intergenic
993260684 5:85655067-85655089 CCCTCCCACCACAGACCCAGAGG + Intergenic
997414371 5:133713685-133713707 CCCTCCCACCCAGGACCCAGTGG - Intergenic
998364155 5:141618302-141618324 TCCTCCCGCCCAGTCCCCCGTGG - Intronic
1002447428 5:179297989-179298011 CCCTCCTCCCCAGGGCCCCGGGG + Intronic
1002518350 5:179775592-179775614 TCCTCCCTCCCAAGGCCCCCAGG + Exonic
1004044564 6:12012072-12012094 CCTTCCCGCCCCGGGCCCCGCGG + Intronic
1006459732 6:34151508-34151530 CCCTTCCGCCCAAGACCTCGTGG + Intronic
1013910692 6:115272626-115272648 CCCTCCAGCCCAACACCATGTGG - Intergenic
1019336037 7:483297-483319 CCCGCCCGCCCAATATCCCACGG - Intergenic
1020016892 7:4836438-4836460 CGCTGCCGCCCAGGGCCCCGAGG - Exonic
1023117386 7:36875724-36875746 CCCTCACCCCCAAGACTCCAGGG - Intronic
1024301232 7:47889173-47889195 CCCTCCAGCCCCAGACCTCCTGG + Intronic
1026143048 7:67722529-67722551 CCCTAGCACCCAAGACCCCCTGG + Intergenic
1033595293 7:142854841-142854863 TCCTCCCGGCCAAGACCCGCGGG + Intergenic
1035019019 7:155789358-155789380 CCTCCCCTCCCATGACCCCGAGG + Intergenic
1037947139 8:22996684-22996706 CCCTCCCACCCCAGGCCCTGAGG - Intronic
1037986687 8:23294716-23294738 CCCTCCTCCTCAGGACCCCGCGG - Intronic
1039089567 8:33813740-33813762 CTCTCCCTCCCAAGTCCCTGTGG + Intergenic
1039581247 8:38668473-38668495 CCCCCCCCCCCAAGGCCCCTCGG + Intergenic
1039854795 8:41402850-41402872 CCTTCCCACCCAAGACTCCAAGG - Intergenic
1041159728 8:55027263-55027285 CCCTCCAGCCCAAGCCTCCAGGG + Intergenic
1042231466 8:66559330-66559352 CCTTCCCGCCCAGGACCACCAGG + Intergenic
1043666820 8:82825407-82825429 CCCTCCCACCCATCACCCCCAGG - Intergenic
1044692878 8:94896196-94896218 CCCACCCGGCCAGGTCCCCGGGG - Intronic
1049157539 8:141075990-141076012 CCCTCCCGCCCAAGAGCTCCTGG - Intergenic
1049290222 8:141797812-141797834 TCCTGCCGCCCAAGCCCCCAGGG - Intergenic
1049554181 8:143274047-143274069 CCCTCCCACCCAAGACTTGGTGG - Intronic
1049577679 8:143397219-143397241 CCCTGCCGCCCAGCACCCTGTGG - Intergenic
1051105017 9:13569522-13569544 CCCTCCAGCCCCAGCCCCCTCGG + Intergenic
1052313925 9:27097111-27097133 CCCTCCCATCACAGACCCCGAGG + Intergenic
1052860786 9:33436628-33436650 CCCACCCACCCAAGATCCCGTGG + Intergenic
1055147986 9:72959068-72959090 CCCTCCCACCACAGACCCAGAGG - Intronic
1055757848 9:79573447-79573469 CCCCCGCGCCCCGGACCCCGAGG - Intronic
1057311510 9:93946071-93946093 CGCTGCCGCCCCAGCCCCCGCGG - Intergenic
1060128660 9:121074811-121074833 GCCTCGCGCCCAAGACTCCCCGG + Intergenic
1060206173 9:121684190-121684212 CCCTCCCGCCCATGTCACCATGG + Intronic
1061296648 9:129680474-129680496 CCCACCCGCCCTAGACACCTGGG + Intronic
1061617055 9:131787241-131787263 CCCTCCCACCCAACACCACGAGG - Intergenic
1061957951 9:133973393-133973415 GCCTCCCTCCCATGACCCCCGGG + Intronic
1062035198 9:134379821-134379843 CCCTCCCACACAAGGCCCCAGGG - Intronic
1062100559 9:134726133-134726155 CTCACCCGCCCTAGACCCCGAGG - Intronic
1186669322 X:11754094-11754116 CCCTCCAGCCAAAGACCACTAGG - Intergenic
1187888238 X:23908785-23908807 CCCTCCAGCCAAAGACCACTAGG + Intronic
1190271296 X:48865817-48865839 CCCTCCAGCCAAAGACCACCAGG - Intergenic
1191742381 X:64449369-64449391 CCCTCCTGCCACAGACCCAGAGG - Intergenic
1195368608 X:104150901-104150923 CCCTCTAGCCCAAGACCACCAGG - Intronic
1199337985 X:146642253-146642275 CCCACCGGCCCAACACCACGTGG - Intergenic
1200053927 X:153448869-153448891 CCCTGCCCCCCAAGCCCCAGGGG + Intronic
1201188977 Y:11430361-11430383 CCCTCTCCCCCCAGTCCCCGTGG + Intergenic