ID: 900222122

View in Genome Browser
Species Human (GRCh38)
Location 1:1514561-1514583
Sequence TAGGCACGAACTGGGCTGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 2, 1: 0, 2: 0, 3: 3, 4: 58}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900222122 Original CRISPR TAGGCACGAACTGGGCTGAC GGG (reversed) Intronic
900214911 1:1476207-1476229 TAGGCACGAACTGGGCTGACGGG - Intronic
900222122 1:1514561-1514583 TAGGCACGAACTGGGCTGACGGG - Intronic
903271974 1:22195038-22195060 TGGTCTCGAACTGGGATGACAGG - Intergenic
904005535 1:27361319-27361341 TAGGCGGGACCTGGGGTGACTGG - Intronic
905783965 1:40737713-40737735 TAGGAAAGAACTGGGCGAACTGG + Intronic
905943044 1:41879241-41879263 TAGGCAATAACTGTGCTGAAAGG - Intronic
910825540 1:91404195-91404217 CAGGCACCAACAGGGCTGGCTGG + Intronic
912577642 1:110688425-110688447 TTGGCAGAAATTGGGCTGACTGG - Intergenic
913997165 1:143661000-143661022 AAGCCACCAACAGGGCTGACTGG + Intergenic
915007684 1:152655402-152655424 TAGGCAGGCACTCGCCTGACTGG - Intergenic
924471232 1:244344266-244344288 TAGGTAAGCACTGGGTTGACTGG - Intergenic
1063469438 10:6272634-6272656 ATGGCACGATCTGGGCTCACTGG - Intergenic
1065550484 10:26864254-26864276 TAGGCACGGACTGGGCACAGTGG + Intergenic
1068091244 10:52435043-52435065 TAAGCACGTACTGGGATTACAGG + Intergenic
1069745335 10:70711471-70711493 CAGACACAAACTGGGGTGACTGG - Intronic
1083689912 11:64401256-64401278 TGGGCAAGCACTGGGCTGGCTGG - Intergenic
1085631947 11:78125748-78125770 ATGGCACGATCTCGGCTGACTGG - Intronic
1087608349 11:100404913-100404935 TAGGCAGGAACTGGGGTGCACGG + Intergenic
1088747626 11:112817598-112817620 TAGGCAGGACTTGGGATGACAGG + Intergenic
1088892688 11:114057877-114057899 TAGGAAAGAACTGGGCTGCAAGG - Intergenic
1089214992 11:116829902-116829924 TAGGGATGAACTGAGCAGACAGG - Exonic
1089842328 11:121428942-121428964 GAGGCACGCAGTGGGCTGAGTGG + Intergenic
1102057205 12:109905520-109905542 AAGGCCTGAACTGGGCTGGCAGG + Intronic
1104509099 12:129360131-129360153 TAGGCAGGGCCTGGGTTGACAGG - Intronic
1107777427 13:43861126-43861148 TTGGCTTTAACTGGGCTGACAGG + Intronic
1108416773 13:50205554-50205576 TAGGGAAGAACAGGGCTGACTGG - Intronic
1120038900 14:79729886-79729908 GAGGCACTAATTGGGCTGACTGG + Intronic
1129296957 15:74604861-74604883 TGGGCAGGAGCTGGGCTGCCTGG - Intronic
1130616058 15:85409234-85409256 TAGGCACGATCTCTGCTCACTGG + Intronic
1134893065 16:17858421-17858443 TAGGCAAGAACAAGGCTAACAGG + Intergenic
1137710346 16:50562689-50562711 TAGGCAACAGCTGGGCCGACTGG + Intronic
1139434238 16:66926894-66926916 TAGGCAAAAGCTGGGCTGAGGGG + Intergenic
1144521488 17:15955455-15955477 GTGGCACGATCTGGGCTCACTGG + Intronic
1146943983 17:36861903-36861925 TATGCTCCAACTTGGCTGACTGG + Intergenic
1149570459 17:57668594-57668616 TGTGCATGCACTGGGCTGACAGG - Intronic
1157357203 18:46946813-46946835 TAGTCAGTTACTGGGCTGACCGG - Exonic
1166641330 19:44497625-44497647 TGGGCACAAGCTGGGCTTACAGG - Intronic
1168014964 19:53565583-53565605 GTGGCACGATCTGGGCTCACTGG + Intronic
926182391 2:10656706-10656728 TAGGCACGAACTGCTCAGGCTGG + Intronic
940657750 2:156508966-156508988 TAGGCATGAACTAGGCTGTCAGG - Intronic
941453218 2:165684947-165684969 TGAGCACCAACTGGGCTGAAAGG - Exonic
948608526 2:239151959-239151981 TGGGAACGAACTGTGCTGGCTGG + Intronic
1173795752 20:45858065-45858087 TAGGCACGCATTGGGCTGCGTGG + Intronic
1174197677 20:48785264-48785286 CAGGCAGGAAGTAGGCTGACAGG - Intronic
961596687 3:128023211-128023233 ATGGCACGATCTGGGCTCACTGG - Intergenic
962631427 3:137280084-137280106 TAGGCAGGCATTGGGGTGACAGG + Intergenic
969369284 4:6720986-6721008 GAGGCGGGAGCTGGGCTGACGGG - Intergenic
973190097 4:47376711-47376733 GAGGCACAAGCTAGGCTGACAGG + Intronic
983619285 4:169743048-169743070 GTGGCACGATCTCGGCTGACTGG - Intronic
985233080 4:187842909-187842931 AAGGCATGAAATGGGATGACAGG - Intergenic
992420194 5:76596220-76596242 TAGTCACGAATTAGGCAGACAGG + Intronic
999158050 5:149472571-149472593 CAGGCACGCAGTGGGCTGTCTGG - Intergenic
1003848461 6:10198102-10198124 TAGGGAAGAACTGGGTTGGCTGG - Intronic
1007163392 6:39810939-39810961 TGGCCACAAACTGGGCTGAGGGG - Intronic
1022663843 7:32390567-32390589 TAGGGATGAACTGGTGTGACTGG - Intergenic
1032199978 7:129813651-129813673 TTGTCAGGAACTGGGCTGAGAGG - Intergenic
1032533026 7:132637553-132637575 TAGGCAGGAGCTGGGATGAGGGG - Intronic
1046771008 8:118116464-118116486 TAGGCAGGAAATGGGGTGAGAGG - Intergenic
1047926933 8:129691327-129691349 GACCCAAGAACTGGGCTGACAGG + Intergenic
1061481035 9:130897847-130897869 TAGGCAGGGTCTGGGCTGCCTGG + Intergenic
1185743534 X:2553365-2553387 GTGGCACGATCTGGGCTCACTGG + Intergenic
1196861668 X:120034428-120034450 TAGGCAGGATATGAGCTGACAGG + Intergenic
1199259775 X:145758922-145758944 TAGGCACAAACTGGGGCGATAGG + Intergenic