ID: 900223171

View in Genome Browser
Species Human (GRCh38)
Location 1:1520247-1520269
Sequence CCTTCAGGCGGATCTGCTCG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 2, 1: 0, 2: 0, 3: 4, 4: 63}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900223171_900223179 15 Left 900223171 1:1520247-1520269 CCGCGAGCAGATCCGCCTGAAGG 0: 2
1: 0
2: 0
3: 4
4: 63
Right 900223179 1:1520285-1520307 AGACCGTCTTGGAGTCCATCAGG 0: 2
1: 1
2: 0
3: 2
4: 38
900223171_900223182 30 Left 900223171 1:1520247-1520269 CCGCGAGCAGATCCGCCTGAAGG 0: 2
1: 0
2: 0
3: 4
4: 63
Right 900223182 1:1520300-1520322 CCATCAGGTGAGCACTGCCGAGG 0: 1
1: 2
2: 1
3: 12
4: 101
900223171_900223177 4 Left 900223171 1:1520247-1520269 CCGCGAGCAGATCCGCCTGAAGG 0: 2
1: 0
2: 0
3: 4
4: 63
Right 900223177 1:1520274-1520296 CGAGCACCGTCAGACCGTCTTGG 0: 2
1: 0
2: 0
3: 0
4: 16

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900223171 Original CRISPR CCTTCAGGCGGATCTGCTCG CGG (reversed) Exonic