ID: 900223177

View in Genome Browser
Species Human (GRCh38)
Location 1:1520274-1520296
Sequence CGAGCACCGTCAGACCGTCT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 18
Summary {0: 2, 1: 0, 2: 0, 3: 0, 4: 16}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900223170_900223177 29 Left 900223170 1:1520222-1520244 CCGAGCGGGAGAATGCAGACATC 0: 2
1: 0
2: 0
3: 11
4: 123
Right 900223177 1:1520274-1520296 CGAGCACCGTCAGACCGTCTTGG 0: 2
1: 0
2: 0
3: 0
4: 16
900223171_900223177 4 Left 900223171 1:1520247-1520269 CCGCGAGCAGATCCGCCTGAAGG 0: 2
1: 0
2: 0
3: 4
4: 63
Right 900223177 1:1520274-1520296 CGAGCACCGTCAGACCGTCTTGG 0: 2
1: 0
2: 0
3: 0
4: 16
900223174_900223177 -8 Left 900223174 1:1520259-1520281 CCGCCTGAAGGCGGCCGAGCACC 0: 1
1: 1
2: 1
3: 5
4: 95
Right 900223177 1:1520274-1520296 CGAGCACCGTCAGACCGTCTTGG 0: 2
1: 0
2: 0
3: 0
4: 16

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900223177 Original CRISPR CGAGCACCGTCAGACCGTCT TGG Exonic