ID: 900223177

View in Genome Browser
Species Human (GRCh38)
Location 1:1520274-1520296
Sequence CGAGCACCGTCAGACCGTCT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 18
Summary {0: 2, 1: 0, 2: 0, 3: 0, 4: 16}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900223174_900223177 -8 Left 900223174 1:1520259-1520281 CCGCCTGAAGGCGGCCGAGCACC 0: 1
1: 1
2: 1
3: 5
4: 95
Right 900223177 1:1520274-1520296 CGAGCACCGTCAGACCGTCTTGG 0: 2
1: 0
2: 0
3: 0
4: 16
900223171_900223177 4 Left 900223171 1:1520247-1520269 CCGCGAGCAGATCCGCCTGAAGG 0: 2
1: 0
2: 0
3: 4
4: 63
Right 900223177 1:1520274-1520296 CGAGCACCGTCAGACCGTCTTGG 0: 2
1: 0
2: 0
3: 0
4: 16
900223170_900223177 29 Left 900223170 1:1520222-1520244 CCGAGCGGGAGAATGCAGACATC 0: 2
1: 0
2: 0
3: 11
4: 123
Right 900223177 1:1520274-1520296 CGAGCACCGTCAGACCGTCTTGG 0: 2
1: 0
2: 0
3: 0
4: 16

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900223177 Original CRISPR CGAGCACCGTCAGACCGTCT TGG Exonic
900210249 1:1452090-1452112 GAAGCACCATCAGACCTTCTTGG + Exonic
900216056 1:1482271-1482293 CGAGCACCGTCAGACCGTCTTGG + Exonic
900223177 1:1520274-1520296 CGAGCACCGTCAGACCGTCTTGG + Exonic
909974109 1:82025334-82025356 CGAGCACCATCAAACTGGCTGGG + Intergenic
1071173677 10:82898425-82898447 TGAGCACCTTAAGACCATCTGGG - Intronic
1072710927 10:97714995-97715017 CGAGCACAGAGAGACCGGCTGGG - Exonic
1103904286 12:124319528-124319550 AGAGCATCATCAGACTGTCTAGG + Intergenic
1122326484 14:100883729-100883751 TGAGCACAATCAGACTGTCTAGG + Exonic
1122576713 14:102747508-102747530 CGGGCACAGGCAGACGGTCTGGG - Intergenic
1143543751 17:7584446-7584468 GGGTCACCGTCAGACCGTTTGGG + Intronic
1151323614 17:73365929-73365951 CAAGGACAGTCAGACCCTCTGGG + Intronic
1152555193 17:81049556-81049578 CCAGCACTGTCAGGGCGTCTGGG + Intronic
1171390755 20:24800253-24800275 CGAGCACAGTAAGACCCTCAGGG - Intergenic
1174588621 20:51627647-51627669 CGAGCACCCGCAGCCCTTCTCGG + Exonic
1179070872 21:38069590-38069612 CAAGCACCATCAGAGGGTCTTGG - Intronic
961216099 3:125161957-125161979 CAAGCCCAGTCAGACCTTCTTGG - Intronic
967928287 3:194670457-194670479 CTAGCACAGTCAGACAATCTGGG - Intronic
1012946780 6:105474700-105474722 CCAGCACCTTCAGACTGCCTGGG - Intergenic