ID: 900223179

View in Genome Browser
Species Human (GRCh38)
Location 1:1520285-1520307
Sequence AGACCGTCTTGGAGTCCATC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 43
Summary {0: 2, 1: 1, 2: 0, 3: 2, 4: 38}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900223174_900223179 3 Left 900223174 1:1520259-1520281 CCGCCTGAAGGCGGCCGAGCACC 0: 1
1: 1
2: 1
3: 5
4: 95
Right 900223179 1:1520285-1520307 AGACCGTCTTGGAGTCCATCAGG 0: 2
1: 1
2: 0
3: 2
4: 38
900223171_900223179 15 Left 900223171 1:1520247-1520269 CCGCGAGCAGATCCGCCTGAAGG 0: 2
1: 0
2: 0
3: 4
4: 63
Right 900223179 1:1520285-1520307 AGACCGTCTTGGAGTCCATCAGG 0: 2
1: 1
2: 0
3: 2
4: 38
900223175_900223179 0 Left 900223175 1:1520262-1520284 CCTGAAGGCGGCCGAGCACCGTC 0: 1
1: 1
2: 0
3: 4
4: 37
Right 900223179 1:1520285-1520307 AGACCGTCTTGGAGTCCATCAGG 0: 2
1: 1
2: 0
3: 2
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900223179 Original CRISPR AGACCGTCTTGGAGTCCATC AGG Exonic
900210251 1:1452101-1452123 AGACCTTCTTGGAGTCCATCAGG + Exonic
900216058 1:1482282-1482304 AGACCGTCTTGGAGTCCATCAGG + Exonic
900223179 1:1520285-1520307 AGACCGTCTTGGAGTCCATCAGG + Exonic
905471189 1:38193339-38193361 AGGCAGTCTTGGATTCCCTCTGG + Intergenic
1063800821 10:9575503-9575525 AGACTGCCTTGGACTCCAGCTGG + Intergenic
1067427659 10:46221795-46221817 AGCCCGTCTTAGGGTCCATATGG - Intergenic
1073046129 10:100639620-100639642 AGAGCATCCTGGTGTCCATCTGG - Intergenic
1073111723 10:101066670-101066692 AGGGCGTCTTGGAGCCCAGCTGG - Intronic
1077870493 11:6258577-6258599 ACATCGTATTGGAGTTCATCCGG + Intergenic
1078390158 11:10930434-10930456 AGTCCATTTTGGAGTCAATCAGG + Intergenic
1103760043 12:123242641-123242663 AGACCTTCTTGAACTCCAGCTGG + Intronic
1118822484 14:69354265-69354287 AGACCCTCTTGAAGGCCCTCTGG - Exonic
1119042011 14:71283057-71283079 TAACAGTTTTGGAGTCCATCAGG - Intergenic
1137061306 16:35793657-35793679 AGAGTGTCTTAGAGGCCATCTGG + Intergenic
1138180091 16:54935292-54935314 AGGCCGTTGTGGACTCCATCAGG + Intergenic
1143460695 17:7101661-7101683 AGACTGTGTTGAAGTCCAGCCGG - Exonic
1144643488 17:16952641-16952663 AGGCCGTCTTGGTTCCCATCAGG - Intronic
1144659895 17:17061142-17061164 TGATCCTCTTGCAGTCCATCTGG + Intronic
1146052147 17:29562729-29562751 AGGTCATCTTGGAGTCCTTCCGG - Exonic
1148032548 17:44631427-44631449 AGACAGTATGGGACTCCATCCGG + Intergenic
927658305 2:24971112-24971134 AGGCCGTCTTGGAATTCATAAGG + Intronic
936091974 2:109507287-109507309 GGACCGTCTTGGAATCGGTCAGG + Intergenic
939486129 2:142813401-142813423 AAACGGTCTTAGATTCCATCAGG + Intergenic
944654320 2:201862756-201862778 CGACCCACTTGGAGTCCAACAGG - Intronic
947118994 2:226797965-226797987 AGACCATCCTGGAGGCCATGCGG - Exonic
1174246997 20:49188606-49188628 AGACCCGCTTCGAGTCCAGCAGG - Intergenic
1174529410 20:51199198-51199220 AGACAGTCCTGGAGTCCCTGAGG - Intergenic
964819781 3:160756445-160756467 AGACCATCGTGAAGTCCAGCCGG + Exonic
973661749 4:53114552-53114574 AGAACCTCTTGGAGTCCAGAAGG + Intronic
987126165 5:14814802-14814824 AGCACCTCTTGGAGTCAATCTGG + Intronic
998393736 5:141804902-141804924 AGCCCGACTTGAAGTCCAGCCGG - Intergenic
1013202589 6:107914293-107914315 AGACATTCTTGGAGACCAACTGG + Intronic
1016766976 6:147805991-147806013 AGACAGTCTCAGAGTTCATCTGG + Intergenic
1018789590 6:167136835-167136857 AGACTGTCTCGGAGCCCATCAGG + Exonic
1022091335 7:27109893-27109915 AGACCTGCTGGGAGTCCCTCTGG - Intronic
1024914000 7:54478099-54478121 AGAGTGTCTTCCAGTCCATCAGG + Intergenic
1029864768 7:103615574-103615596 AGACCCTCTGGGAGACCATCAGG + Intronic
1034956250 7:155337291-155337313 AAACCGTGTTGGTGTTCATCAGG + Intergenic
1042999789 8:74743813-74743835 AGACCATTTTGGACTCCAACAGG + Intronic
1047407807 8:124599702-124599724 AGACCGTTTTGGAGGTCATTTGG - Intronic
1060407042 9:123377957-123377979 GGACCGTCTGGGTGTCCTTCTGG + Exonic
1060992564 9:127857283-127857305 AGTTCTTCCTGGAGTCCATCTGG - Intergenic
1196706941 X:118725108-118725130 AGAGCGTCTTGGATTGAATCAGG - Intergenic