ID: 900223179

View in Genome Browser
Species Human (GRCh38)
Location 1:1520285-1520307
Sequence AGACCGTCTTGGAGTCCATC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 43
Summary {0: 2, 1: 1, 2: 0, 3: 2, 4: 38}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900223174_900223179 3 Left 900223174 1:1520259-1520281 CCGCCTGAAGGCGGCCGAGCACC 0: 1
1: 1
2: 1
3: 5
4: 95
Right 900223179 1:1520285-1520307 AGACCGTCTTGGAGTCCATCAGG 0: 2
1: 1
2: 0
3: 2
4: 38
900223171_900223179 15 Left 900223171 1:1520247-1520269 CCGCGAGCAGATCCGCCTGAAGG 0: 2
1: 0
2: 0
3: 4
4: 63
Right 900223179 1:1520285-1520307 AGACCGTCTTGGAGTCCATCAGG 0: 2
1: 1
2: 0
3: 2
4: 38
900223175_900223179 0 Left 900223175 1:1520262-1520284 CCTGAAGGCGGCCGAGCACCGTC 0: 1
1: 1
2: 0
3: 4
4: 37
Right 900223179 1:1520285-1520307 AGACCGTCTTGGAGTCCATCAGG 0: 2
1: 1
2: 0
3: 2
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900223179 Original CRISPR AGACCGTCTTGGAGTCCATC AGG Exonic