ID: 900223182

View in Genome Browser
Species Human (GRCh38)
Location 1:1520300-1520322
Sequence CCATCAGGTGAGCACTGCCG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 2, 2: 1, 3: 12, 4: 101}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900223178_900223182 -3 Left 900223178 1:1520280-1520302 CCGTCAGACCGTCTTGGAGTCCA 0: 2
1: 1
2: 0
3: 6
4: 68
Right 900223182 1:1520300-1520322 CCATCAGGTGAGCACTGCCGAGG 0: 1
1: 2
2: 1
3: 12
4: 101
900223175_900223182 15 Left 900223175 1:1520262-1520284 CCTGAAGGCGGCCGAGCACCGTC 0: 1
1: 1
2: 0
3: 4
4: 37
Right 900223182 1:1520300-1520322 CCATCAGGTGAGCACTGCCGAGG 0: 1
1: 2
2: 1
3: 12
4: 101
900223171_900223182 30 Left 900223171 1:1520247-1520269 CCGCGAGCAGATCCGCCTGAAGG 0: 2
1: 0
2: 0
3: 4
4: 63
Right 900223182 1:1520300-1520322 CCATCAGGTGAGCACTGCCGAGG 0: 1
1: 2
2: 1
3: 12
4: 101
900223176_900223182 4 Left 900223176 1:1520273-1520295 CCGAGCACCGTCAGACCGTCTTG 0: 2
1: 0
2: 0
3: 1
4: 33
Right 900223182 1:1520300-1520322 CCATCAGGTGAGCACTGCCGAGG 0: 1
1: 2
2: 1
3: 12
4: 101
900223174_900223182 18 Left 900223174 1:1520259-1520281 CCGCCTGAAGGCGGCCGAGCACC 0: 1
1: 1
2: 1
3: 5
4: 95
Right 900223182 1:1520300-1520322 CCATCAGGTGAGCACTGCCGAGG 0: 1
1: 2
2: 1
3: 12
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900223182 Original CRISPR CCATCAGGTGAGCACTGCCG AGG Exonic