ID: 900225695

View in Genome Browser
Species Human (GRCh38)
Location 1:1532778-1532800
Sequence GGGCCCCGGACCCACAGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 6, 2: 4, 3: 14, 4: 168}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900225688_900225695 23 Left 900225688 1:1532732-1532754 CCTCTCTTGGGTGCGCTCAAGAC 0: 1
1: 3
2: 0
3: 2
4: 46
Right 900225695 1:1532778-1532800 GGGCCCCGGACCCACAGTGGTGG 0: 1
1: 6
2: 4
3: 14
4: 168
900225689_900225695 1 Left 900225689 1:1532754-1532776 CCAAAAATGATGTTGAGCAGTCC 0: 4
1: 0
2: 0
3: 6
4: 112
Right 900225695 1:1532778-1532800 GGGCCCCGGACCCACAGTGGTGG 0: 1
1: 6
2: 4
3: 14
4: 168
900225687_900225695 24 Left 900225687 1:1532731-1532753 CCCTCTCTTGGGTGCGCTCAAGA 0: 1
1: 3
2: 1
3: 5
4: 71
Right 900225695 1:1532778-1532800 GGGCCCCGGACCCACAGTGGTGG 0: 1
1: 6
2: 4
3: 14
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900225695 Original CRISPR GGGCCCCGGACCCACAGTGG TGG Intronic
900213154 1:1467353-1467375 GGGCCCCTGAGCCACAGTGGCGG + Intronic
900213169 1:1467407-1467429 GGGCCCCCGACCCACAGTGGTGG + Intronic
900218366 1:1494409-1494431 GGGCCCCTGAGCCACAGTGGCGG + Intronic
900218380 1:1494463-1494485 GGGCCCCCGACCCACAGTGGCGG + Intronic
900218396 1:1494517-1494539 GGGCCCCCGACCCACAGTGGCGG + Intronic
900220723 1:1508174-1508196 GGGCCCCTGAGCCACAGTGGCGG + Intergenic
900220735 1:1508228-1508250 GGGCCCCTGACCCACAGTGGTGG + Intergenic
900225695 1:1532778-1532800 GGGCCCCGGACCCACAGTGGTGG + Intronic
900225708 1:1532832-1532854 AGGCCCCTGACCCACAGTGGCGG + Intronic
900225722 1:1532886-1532908 GGGCCCCTGACCCACAGTGGCGG + Intronic
900225737 1:1532940-1532962 GGGCCCCCGACCCACAGTGGTGG + Intronic
900226240 1:1534832-1534854 GGCCCCTGGCCCCGCAGTGGCGG - Intergenic
900618540 1:3576538-3576560 AGTCCCCAGACCCAGAGTGGAGG + Intronic
901679091 1:10902755-10902777 GAGCCCTTGAGCCACAGTGGAGG - Intergenic
902286348 1:15410615-15410637 GGGCCCGGGACCCACACGTGTGG - Intronic
903013675 1:20348272-20348294 GGGCCCTGGCCCAACAGTGGAGG + Exonic
904493950 1:30876557-30876579 TGCCCCTGGACCCACAGAGGTGG - Exonic
905636793 1:39559422-39559444 TGACCCTGGACCCAGAGTGGTGG - Intergenic
906206966 1:43992062-43992084 GGGCCAGGGACCCGCAGAGGTGG - Intronic
907866257 1:58402242-58402264 TGGCCTGGGTCCCACAGTGGAGG - Intronic
909001407 1:70221659-70221681 GGGGCCCGGACCTGCAGTGCTGG - Exonic
911924798 1:103816713-103816735 AGGCCCCACACCCAGAGTGGAGG + Intergenic
915294279 1:154909209-154909231 AGGTCCCAGACACACAGTGGTGG - Intergenic
920671962 1:208010601-208010623 AGGCCTCGGAGACACAGTGGTGG + Intergenic
922602943 1:226870776-226870798 GGGCCGCAGACCCACAGCCGGGG - Intronic
923777878 1:236996169-236996191 TTGCCCCAGACCCCCAGTGGAGG - Intergenic
1070678515 10:78432798-78432820 GAGCCCAGGGCACACAGTGGAGG + Intergenic
1075626432 10:123967445-123967467 AGGACCAGGACCCAGAGTGGAGG + Intergenic
1075908860 10:126106165-126106187 GGTCCCGGGACTCACAGTAGGGG + Intronic
1076379252 10:130014037-130014059 TGGCCCTGGGCACACAGTGGAGG + Intergenic
1077211381 11:1372329-1372351 GGGCCCGGTTCCCACAGGGGAGG - Intergenic
1077438314 11:2555574-2555596 GGGCCCCGCACACACAGGAGTGG - Intronic
1077479594 11:2807450-2807472 TGGCCCCGGGCCCGGAGTGGGGG - Intronic
1077491087 11:2861389-2861411 GGGCCCCGGACCCAGCCTGAGGG - Intergenic
1077894492 11:6443511-6443533 GGACCCAGGACCCACAGAAGGGG - Intergenic
1080639975 11:34152868-34152890 GAGCCCTGGACACCCAGTGGTGG - Intronic
1081572991 11:44303044-44303066 GGGACCGGGGCCCACAGTTGCGG - Intronic
1083033522 11:59615574-59615596 CGGCGCCGGTCCCCCAGTGGTGG - Exonic
1083826072 11:65204909-65204931 GCGCCCCCGACCCGCAGTGCAGG + Intronic
1083842973 11:65315190-65315212 GGGGCCCGGACACAAAATGGAGG - Intronic
1084506228 11:69570117-69570139 GGGCTCAGGGCCCCCAGTGGAGG + Intergenic
1084594509 11:70108987-70109009 GGGCAAGGGACCCACTGTGGGGG - Intronic
1086345054 11:85887472-85887494 GGGCCTCTGCACCACAGTGGTGG + Intronic
1089110972 11:116055761-116055783 GGGCCACGGGACCACTGTGGAGG + Intergenic
1091953374 12:4614409-4614431 GGGCCCCAAGCCCACAGTGATGG + Exonic
1092225875 12:6748156-6748178 GGGCTACGGCCCCTCAGTGGGGG + Exonic
1096475565 12:51907165-51907187 GGGGTCCGGACCCACAGCCGTGG - Intronic
1099890215 12:88580663-88580685 GGGCCCCGGACCTGCACTGGCGG + Intronic
1103952377 12:124558172-124558194 GAGGCCCAGACCCACAGGGGAGG - Intronic
1104919176 12:132281796-132281818 GGTCCCCGATCCCACAGAGGAGG + Intronic
1104919207 12:132281908-132281930 GGTCCCCGATCCCACAGAGGAGG + Intronic
1104919237 12:132282019-132282041 GGTCCCCGATCCCACAGAGGAGG + Intronic
1104919268 12:132282131-132282153 GGTCCCCGATCCCACAGAGGAGG + Intronic
1104930415 12:132336589-132336611 GGGCCCGGGACCCCGACTGGAGG + Intergenic
1105665565 13:22552284-22552306 GGGCACAGGCCCGACAGTGGAGG + Intergenic
1105876705 13:24560988-24561010 GGGCCCCGCACTCAGAGCGGCGG - Intergenic
1108385493 13:49895787-49895809 GAGGCTGGGACCCACAGTGGAGG - Intergenic
1113909265 13:113834503-113834525 GGCCCCCGGAACCACCGTGAAGG + Intronic
1113977007 13:114235141-114235163 GGGCCCCGCACCCCGAGTCGGGG - Intronic
1113990271 14:16023057-16023079 GGGCCCGGGGCCCACAGTCCTGG - Intergenic
1119555089 14:75546873-75546895 GGGCCTGCAACCCACAGTGGTGG - Exonic
1121544312 14:94752193-94752215 GGGCCCCAGCCCCACAGACGTGG + Intergenic
1121667875 14:95686354-95686376 GGGGCCCGGGCCGGCAGTGGGGG - Intergenic
1122138095 14:99646010-99646032 GGGCACAGCACCCACAGAGGTGG - Intronic
1122871829 14:104642286-104642308 CGGCCCCGGGCCCACAGGGTGGG + Intergenic
1123758773 15:23416941-23416963 GGGTCCCGGACCTGCTGTGGTGG + Intergenic
1127763632 15:62164593-62164615 CGGCCCCGGGCCCACAGCTGCGG - Exonic
1129767376 15:78178883-78178905 GGACCCCGGCTCCCCAGTGGGGG - Intronic
1130086374 15:80780804-80780826 GGGCCACAGACCCCGAGTGGAGG - Intronic
1132567170 16:628862-628884 GGACCCAGGACCCCCCGTGGTGG + Exonic
1136909429 16:34134129-34134151 GGGCCCGGGGCCCACAGTCCTGG - Intergenic
1137294980 16:47083466-47083488 AGGCCTGCGACCCACAGTGGTGG + Exonic
1138029293 16:53547103-53547125 GGGCCCCAGACACACAGGGAAGG + Intergenic
1139653043 16:68372115-68372137 GGGCCCAGGACACACAGTGCAGG + Exonic
1141760699 16:86026672-86026694 CAGCCCCGAACCCCCAGTGGAGG - Intergenic
1144577706 17:16439370-16439392 GGTTCCCCGGCCCACAGTGGGGG + Intergenic
1145972930 17:28967582-28967604 GGGCACCACACCCAGAGTGGAGG + Intronic
1146548764 17:33762234-33762256 GGTCCCAGGACCCAATGTGGTGG - Intronic
1147715815 17:42507549-42507571 GGGCAACGGACCGACAGAGGAGG + Exonic
1151320394 17:73349160-73349182 GGGCCCCGGAGCCAGCCTGGCGG + Intronic
1151728728 17:75898757-75898779 GGGCCCAGACCCCACAGTGTGGG + Exonic
1152068920 17:78125693-78125715 GGGCACTGGAGCCCCAGTGGCGG - Intronic
1152543333 17:80988166-80988188 GCACCCCTGACCCAGAGTGGAGG + Intergenic
1152614490 17:81331525-81331547 GGGCCCCTAGCCCACAGCGGAGG + Intergenic
1152633842 17:81422560-81422582 GGTCCCCGGCCCCACAGTCTGGG - Intronic
1152789937 17:82273459-82273481 GGGAGCCGGACCCGCAGTAGCGG - Exonic
1152889400 17:82871844-82871866 GAACCCAGGAGCCACAGTGGAGG - Intronic
1152900572 17:82938671-82938693 GAGCCCCGGGCCCACCCTGGAGG - Intronic
1155111790 18:22722894-22722916 GGTCCTCGGACCCACAGAGTTGG + Intergenic
1160420476 18:78740489-78740511 CGCCACCTGACCCACAGTGGAGG - Intergenic
1160682485 19:418127-418149 GGGCCCCGCACCAAAAGTGGAGG + Intronic
1160874538 19:1291005-1291027 GGGCCCCTGACCCACAGGGCAGG - Intronic
1161233679 19:3187763-3187785 GCGCCCTGGGGCCACAGTGGTGG + Intronic
1162964636 19:14150127-14150149 GGGCCCCCAGCCCACAGGGGTGG - Exonic
1163655657 19:18543500-18543522 GGGCGCAGGACCCCAAGTGGGGG - Exonic
1164179490 19:22806940-22806962 GGGCCCCGGGGCCACAGAAGAGG - Intergenic
1164618756 19:29681574-29681596 GGGCCCCAGGCCCAGAATGGAGG + Intergenic
1164679000 19:30121598-30121620 GGGCCCCAGACGCACAGAGAGGG - Intergenic
1165922661 19:39308380-39308402 GGGCGCCGGATCCCCAGCGGTGG + Exonic
1165990875 19:39812696-39812718 GGGCCCCCCACCCACCCTGGGGG + Intergenic
1166118976 19:40673612-40673634 AGGGCCAGGAGCCACAGTGGGGG + Exonic
1167001147 19:46746337-46746359 GGGCCCTGGCCCCACTGGGGCGG - Exonic
1167593642 19:50416863-50416885 GGGCCGAGGACCCTCTGTGGGGG - Intronic
932635782 2:73386397-73386419 AGGCCCAGGACCCACCGAGGGGG - Intronic
937247267 2:120501814-120501836 TGGCCCCAGGCCCACAGCGGAGG + Intergenic
946165772 2:217862984-217863006 GGGCCCCTCACCCACACTGAGGG + Intronic
946337929 2:219050704-219050726 GGGTCCAGGAGTCACAGTGGGGG - Intergenic
947605765 2:231484131-231484153 GGCCCGCGGACCCAGCGTGGGGG + Intergenic
948190530 2:236054855-236054877 GGGCCCGGGCCCGGCAGTGGCGG - Intronic
1169118416 20:3081946-3081968 GGGCCCCTCAGCCAGAGTGGGGG - Intergenic
1170457188 20:16544223-16544245 AGGCCCAGGACTCACAGAGGCGG - Intronic
1170570114 20:17627797-17627819 GAGCCCCAGACACACAGAGGAGG - Intronic
1171486310 20:25489033-25489055 GGTCCCTGGACACACAGAGGCGG + Intronic
1171771605 20:29326615-29326637 GGGCCCGGGGCCCACAGTCCTGG + Intergenic
1171813557 20:29763847-29763869 GGGCCCGGGGCCCACAGTTCTGG + Intergenic
1172450711 20:35020706-35020728 GGGCCCATAACCTACAGTGGAGG - Intronic
1172877883 20:38177137-38177159 GGGACCAGGACCCACAGGGAAGG - Intergenic
1173223602 20:41148365-41148387 GGGCCTAGGACTCATAGTGGTGG - Intronic
1174039276 20:47687486-47687508 TGGCCCCAGACACACAGTGGAGG - Intronic
1175399608 20:58692938-58692960 GGGACTCGGACCCACAGAGCCGG + Exonic
1175801156 20:61801689-61801711 GGGGCCAGGAGCCACAGAGGTGG - Intronic
1176104926 20:63381452-63381474 GGGCCCCCGAGCCACACAGGAGG - Intergenic
1180157059 21:45982907-45982929 GGGCCCCGGCCTCACTCTGGAGG - Intronic
1180317001 22:11284469-11284491 GGGCCCGGGGCCCACAGTCCTGG + Intergenic
1180338326 22:11599040-11599062 GGGCCCGGGGCCCACAGTCCTGG - Intergenic
1181031578 22:20150773-20150795 GGGCAGTGGGCCCACAGTGGAGG - Exonic
1182481189 22:30609883-30609905 GGGACCCAGACCCACAGAGATGG + Intronic
1182752629 22:32654053-32654075 GGGCCCAGTACCCACACTGGGGG + Intronic
1183424743 22:37733434-37733456 GGGCCCCGCACCCCAAGGGGCGG + Intronic
1183619524 22:38964526-38964548 GGGTCGGGGCCCCACAGTGGCGG + Intronic
1184289351 22:43490146-43490168 GGCCCCCGGACCCAATGTTGTGG + Intronic
950535899 3:13577955-13577977 GGGCCCCAGTCTCCCAGTGGAGG + Intronic
954783158 3:53074965-53074987 GGGCCCCAGCCCCAGAGTGAGGG + Intronic
957943654 3:87036596-87036618 GGGCCCAGTGGCCACAGTGGTGG + Intergenic
958004261 3:87792664-87792686 GCGCCCCGGACCCGCAAGGGCGG + Intergenic
959849784 3:111072215-111072237 GGCGCCCGCACCCTCAGTGGCGG - Intronic
967971830 3:195004992-195005014 GGGCCACCCACCCACAGTGCAGG + Intergenic
972576171 4:40354049-40354071 GGGCCTCGGCCCCACAGAAGTGG - Exonic
973867095 4:55125216-55125238 GGGCTCCTTACCCACAGAGGCGG + Exonic
984882825 4:184425482-184425504 GGGCCTCGGGGCCACAGTGCAGG + Intronic
986213357 5:5694950-5694972 AGGCCCCCAACCCCCAGTGGAGG - Intergenic
988033563 5:25797152-25797174 GGCCCCCTGCCCCACAGAGGAGG + Intergenic
990545406 5:56816224-56816246 GCGCCCCGGACCCAGCCTGGGGG + Intronic
992067380 5:73120442-73120464 GCGCCCCGGGCCCCCAGTGGCGG + Exonic
995055852 5:107757966-107757988 GGGCCCCAGACCCACAGCACTGG - Intergenic
998687639 5:144547632-144547654 GGGCCTGGGACTCACAGTGTAGG + Intergenic
1000212347 5:159119252-159119274 GGGCCCCGCACTCAGAGCGGCGG + Intergenic
1001856044 5:175011902-175011924 GGGCCCGGGACCCACAGCTGAGG + Intergenic
1002401061 5:178991802-178991824 GGGCCCGGGGCCCTCAGTTGGGG - Intronic
1004124932 6:12864253-12864275 GGGCCCCATCCCCACAGTGTCGG + Intronic
1004424400 6:15497691-15497713 GGGGCCCAGACCCAGAGTGGGGG - Intronic
1006844168 6:37051113-37051135 GGACCCTGTCCCCACAGTGGTGG - Intergenic
1007082072 6:39114829-39114851 TGGCCTCGGAGCCACAGTCGAGG - Intronic
1008865482 6:56204646-56204668 GGGTCAGGGACCCACTGTGGAGG - Intronic
1012062861 6:94511043-94511065 GGACCTCGGACCCACGGTGGAGG - Intergenic
1015143115 6:129958121-129958143 GGGCCCCTGGGACACAGTGGAGG - Intergenic
1019542706 7:1558768-1558790 GGGCCCCGGACACAGACTGAGGG + Intronic
1019731690 7:2632517-2632539 GGGCCGTGGACCCTCACTGGGGG - Intronic
1020171836 7:5851084-5851106 CTGCCCTGGCCCCACAGTGGAGG + Intergenic
1022377279 7:29826292-29826314 TGGCCCCAGATCCACAGTGTCGG + Intronic
1023233038 7:38053812-38053834 GTGGCAGGGACCCACAGTGGGGG + Intergenic
1023621226 7:42075065-42075087 GGGCCTAGAACACACAGTGGGGG + Intronic
1027592529 7:80134681-80134703 GGGCGCCAGGCCCTCAGTGGTGG + Intronic
1029312267 7:99678276-99678298 GGGTCCTGGCCCCACCGTGGAGG - Intronic
1029314417 7:99698365-99698387 GGGTCCTGGCCCCACAGTGGAGG - Intronic
1029320056 7:99750861-99750883 GGGTCCTGGCCCCACAGTGGAGG - Intergenic
1029524955 7:101088654-101088676 GGACCCCAGCCCCACAGGGGTGG + Exonic
1030311874 7:108077168-108077190 TGGCCTCAGCCCCACAGTGGAGG - Intronic
1032024926 7:128433635-128433657 GGGCCTTAGAGCCACAGTGGTGG + Intergenic
1034274201 7:149816927-149816949 AGACCCATGACCCACAGTGGAGG - Intergenic
1035735672 8:1885829-1885851 GGGCCAGGAACCTACAGTGGAGG - Intronic
1036560880 8:9899420-9899442 GGGGCCCGCGCCCACAGTCGCGG + Intergenic
1036581089 8:10076687-10076709 GGTTCCCTTACCCACAGTGGTGG + Intronic
1037835624 8:22213308-22213330 GGGCCCTGGGGCCACACTGGTGG - Intergenic
1038554121 8:28494561-28494583 GGGGCCCGGGCCCGCGGTGGCGG + Intronic
1038584554 8:28777298-28777320 GGGCCACGGAACCACTGTGCTGG - Intronic
1045294286 8:100860352-100860374 GGTCTCCGGCTCCACAGTGGAGG - Intergenic
1047774419 8:128057765-128057787 AGGCCCCGCACACACCGTGGGGG - Intergenic
1049721238 8:144116442-144116464 GCGGCCTGAACCCACAGTGGCGG + Exonic
1049772613 8:144390757-144390779 GTGCCCTGGGCACACAGTGGTGG + Intronic
1049949251 9:628576-628598 GGGCACTTGAACCACAGTGGTGG + Intronic
1051445547 9:17135456-17135478 GGGTCCCGGCCCCGCTGTGGTGG - Intronic
1060821027 9:126661685-126661707 GGGCCCCGCAGCCACACTGCAGG - Intronic
1061387897 9:130301216-130301238 AGGCCCCGGAACCACAGTAGGGG - Intronic
1061710009 9:132480901-132480923 GGGCCCCCGGACCACAATGGGGG - Intronic
1061802773 9:133121233-133121255 GGGCCGCGGGCTCACAGCGGTGG - Intronic
1062064892 9:134521535-134521557 CTGCCCCGGTCCCACAGTGTGGG + Intergenic
1062093517 9:134690795-134690817 GTGCCCAGGATTCACAGTGGTGG + Intronic
1062500606 9:136850414-136850436 GGGCCCAGGGCCCAAAGTGCTGG - Intronic
1190335554 X:49259612-49259634 GGGGCCCGGAGCCATTGTGGAGG - Intronic
1190464012 X:50707929-50707951 GGGCCCTGGACCCACCCTGCAGG + Intronic
1196153479 X:112401340-112401362 GGTACCTGGACCCACAATGGTGG - Intergenic
1199671078 X:150148822-150148844 GGGCCACAGCACCACAGTGGTGG - Intergenic