ID: 900228009

View in Genome Browser
Species Human (GRCh38)
Location 1:1541623-1541645
Sequence GACCCTCGCCCCTGAGGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 174}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900228009_900228016 -1 Left 900228009 1:1541623-1541645 CCACCTCCTCAGGGGCGAGGGTC 0: 1
1: 0
2: 3
3: 21
4: 174
Right 900228016 1:1541645-1541667 CGGGCCAGGAATTCAGGACCAGG 0: 1
1: 0
2: 3
3: 41
4: 470
900228009_900228015 -7 Left 900228009 1:1541623-1541645 CCACCTCCTCAGGGGCGAGGGTC 0: 1
1: 0
2: 3
3: 21
4: 174
Right 900228015 1:1541639-1541661 GAGGGTCGGGCCAGGAATTCAGG 0: 1
1: 0
2: 0
3: 17
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900228009 Original CRISPR GACCCTCGCCCCTGAGGAGG TGG (reversed) Intergenic
900137221 1:1122691-1122713 GCCCCTCGCCCGTGGGGAGGTGG + Intergenic
900228009 1:1541623-1541645 GACCCTCGCCCCTGAGGAGGTGG - Intergenic
901818106 1:11806328-11806350 GACCCGCACCCCCGAGGAGCTGG + Exonic
902926616 1:19700224-19700246 GACCCTCCAGCCAGAGGAGGGGG - Intronic
902979574 1:20113338-20113360 GCCCTTTGACCCTGAGGAGGTGG + Exonic
903996105 1:27306422-27306444 GACCCTCTGCCCTGGGCAGGAGG + Exonic
904030365 1:27529637-27529659 GACCCTCACACCTTAGGACGGGG - Intergenic
904382345 1:30119904-30119926 GACCCTCTCCTCAGAGCAGGTGG + Intergenic
904441460 1:30534609-30534631 GACCCTCTCCCCAGAACAGGTGG + Intergenic
905046216 1:35004681-35004703 TACCCACTCCCCTGAGGCGGGGG + Intronic
906142200 1:43540488-43540510 GACCCCAGCCCCAGAGGAAGGGG + Intronic
906551300 1:46668340-46668362 GGCCGACGCGCCTGAGGAGGAGG - Exonic
907526450 1:55056726-55056748 GAGCCTCGGCCCTGAGGAGCTGG + Intronic
911088288 1:93997936-93997958 GATCCTCGCCAGGGAGGAGGAGG + Exonic
914754033 1:150553101-150553123 GACCCTGGCCCCGGGGGAGGAGG - Exonic
914847322 1:151290359-151290381 GGCCCTTGCTTCTGAGGAGGGGG - Intronic
915108412 1:153548299-153548321 GTGCCTCCCCCCGGAGGAGGAGG + Intronic
916588298 1:166166606-166166628 GCCCCTCGCCGGAGAGGAGGAGG + Exonic
916677212 1:167074185-167074207 GACTCTCCTCCCTCAGGAGGTGG + Intronic
922169400 1:223142538-223142560 CACCCTCGCCCCTTAGGAAATGG + Intronic
922283502 1:224147635-224147657 GACCCAAACCCCTGAGGATGCGG + Intronic
922548263 1:226474655-226474677 AACCCTTGCTCCAGAGGAGGAGG + Intergenic
923323136 1:232856408-232856430 GGCCCTCACCCCTGAAGAGTTGG - Intergenic
1066180707 10:32958271-32958293 TCCTCCCGCCCCTGAGGAGGAGG - Intronic
1069383765 10:67865686-67865708 GACCCTCCCTCCTGAGTAGCTGG + Intergenic
1070310759 10:75272089-75272111 AGCCCTCTGCCCTGAGGAGGAGG - Intergenic
1071597999 10:86942149-86942171 GACCCACACCCCTGAGAAGCAGG + Intronic
1072834511 10:98696578-98696600 GACCCTCGCCCCAGTGGTGTGGG - Intronic
1074869382 10:117564925-117564947 AACCCTCCCCCGTGAGAAGGGGG - Intergenic
1075413666 10:122247336-122247358 GGCCCTCGTCACTGGGGAGGGGG - Intronic
1076994746 11:292457-292479 TGCCCTCGCCCTGGAGGAGGGGG - Intronic
1077108680 11:852809-852831 GAACTTCGCCCCTGAGAAGACGG - Intronic
1077365077 11:2158362-2158384 GACACTGGCCCCGGAAGAGGAGG - Intronic
1079259150 11:18861103-18861125 GACCCTTCCTCCTGTGGAGGTGG + Intergenic
1080433202 11:32217238-32217260 GGCCCTCACCCCTGTGGGGGTGG - Intergenic
1083721290 11:64604846-64604868 GAGCCTCACCCCTCAGGAGCTGG + Intergenic
1084014083 11:66368582-66368604 GGCCCTGGCCGCTGAGGAAGAGG + Exonic
1086382761 11:86274790-86274812 CACCCTAGCCCGAGAGGAGGCGG + Intronic
1089297950 11:117481122-117481144 GCCCCTGGGCCCTGGGGAGGTGG + Intronic
1091353483 11:134915948-134915970 GGCCCTAGCCCCTGGGGAGAAGG - Intergenic
1091826972 12:3520102-3520124 GATCCTTGCAGCTGAGGAGGAGG + Intronic
1095962377 12:47843845-47843867 GACCCTCTCCCCTGGGGAGGGGG + Exonic
1100618407 12:96249374-96249396 GACGCGCGCCACTGCGGAGGGGG + Intronic
1100823875 12:98456972-98456994 GACCGCCGCCCCAGAGGAGGAGG + Intergenic
1101510624 12:105389511-105389533 GGCCCTCTCCCCTGGAGAGGAGG + Intronic
1101717022 12:107320180-107320202 GTCCCAAGCCGCTGAGGAGGCGG + Intronic
1101816749 12:108151447-108151469 AACCCCCACCCCTGGGGAGGAGG - Intronic
1103443299 12:120979038-120979060 GAACCTCAGCCCTGAGGAGGCGG + Exonic
1103716076 12:122946117-122946139 GAGCTTCGCCAATGAGGAGGAGG - Exonic
1103761631 12:123254375-123254397 GATCCAAGTCCCTGAGGAGGCGG + Intronic
1104262117 12:127194020-127194042 GACCCTGGGGCCTGTGGAGGAGG - Intergenic
1104635901 12:130437699-130437721 GGCCCTGGCCCCTGCAGAGGAGG - Intronic
1112709211 13:102107507-102107529 GAGACTGGCCCCTGAGGAAGTGG + Intronic
1113941918 13:114022929-114022951 GACCCTGACCCCTCAGGAGGTGG + Intronic
1115342161 14:32304463-32304485 GACGTTCCACCCTGAGGAGGAGG + Intergenic
1116964262 14:50998226-50998248 CTCCCTCGCCCCTCAGAAGGGGG - Intronic
1119705587 14:76780902-76780924 GATCCTTGCAGCTGAGGAGGAGG + Exonic
1121343115 14:93116417-93116439 GACCCGCACCCCTGAGGAAGGGG - Intergenic
1122062104 14:99143048-99143070 CAACCTCTCCCCTGAGGAGCTGG - Intergenic
1122721587 14:103725395-103725417 GACCCACGCCCCTCAGAAGCAGG + Intronic
1126665694 15:51074780-51074802 GACCCTCGCCCAGGTGGAAGAGG + Intronic
1127367933 15:58309127-58309149 GACGCACGTCCCAGAGGAGGAGG - Intronic
1129888961 15:79058453-79058475 GACCCTCGCCACAGAGCATGAGG - Exonic
1131063252 15:89417331-89417353 TACCTTCGCCCCAGAGCAGGCGG + Intergenic
1131231151 15:90660568-90660590 GACTATCGGCCCTGAGTAGGAGG + Intergenic
1132250089 15:100329418-100329440 GATCCTCGCTCCTGAGTAGCTGG - Intronic
1132608151 16:802030-802052 AACCATCTGCCCTGAGGAGGAGG - Intergenic
1132849284 16:2017265-2017287 GACCCTCACGCCTCAGGAGTGGG + Intronic
1133966710 16:10537017-10537039 GACCCTGGCCCGGGAGGTGGAGG + Intronic
1134850429 16:17474297-17474319 GCCCCTGGCCCCTGAGGGAGTGG - Intergenic
1135500401 16:22991061-22991083 GACACAAGCCCCTGAGGTGGAGG - Intergenic
1136358849 16:29764594-29764616 CACCCTCGCCCCTCTGCAGGGGG + Intergenic
1136381767 16:29899335-29899357 GACCCAGGCGCCTGAGCAGGAGG - Exonic
1136394759 16:29986957-29986979 GACTCCCGTCCCTGAGGAGGAGG + Exonic
1136539976 16:30923722-30923744 CACCCTCCCGCTTGAGGAGGGGG + Intronic
1138347230 16:56327464-56327486 GCCACTCGCTCCTGAGGTGGGGG + Intronic
1139908166 16:70380810-70380832 GGCTCTGGCCCCTGGGGAGGGGG - Exonic
1141468631 16:84223381-84223403 GACCAGCGCCCCAGGGGAGGAGG + Intronic
1142289300 16:89185460-89185482 GGCCCTGGCTCCTGAGGAGATGG + Intronic
1143184791 17:5003655-5003677 GCCCCGGGCCCCTGAGGAGTCGG - Exonic
1143599739 17:7936700-7936722 GACCCTGGCCCGTGTGGTGGAGG + Exonic
1145144021 17:20466385-20466407 GACCCTGGCCTCTGCTGAGGTGG + Intronic
1145791845 17:27632322-27632344 GACCCTGGCCTCTGCTGAGGTGG - Intronic
1146803242 17:35844347-35844369 GACTCTCGTCCCTCAGGAGGAGG + Exonic
1147671897 17:42181147-42181169 GAACCTGGCCCGTGGGGAGGTGG - Exonic
1148002514 17:44398125-44398147 CACCTTCACCCCTGAGGAGATGG - Exonic
1148139246 17:45316842-45316864 GCCCCTCGCCCCGGAGCAGTGGG - Intronic
1150249847 17:63699515-63699537 GACCCCGGCCCCTGGGGAGCAGG - Intronic
1152131073 17:78476817-78476839 TCCCCTCGCCCCGGGGGAGGGGG - Intronic
1152469724 17:80484005-80484027 GGCCCTGTCCCCAGAGGAGGAGG - Intergenic
1153483954 18:5576383-5576405 GACCCTCGTCCCTCAGGATGAGG + Intronic
1158893684 18:61894587-61894609 GCCCCTCACCCCGGGGGAGGTGG - Intergenic
1160220006 18:76968270-76968292 GACCCTCCACCTGGAGGAGGTGG + Exonic
1160425520 18:78776342-78776364 GCCCCTCTCCTCTGAAGAGGTGG - Intergenic
1161086715 19:2338861-2338883 GACCCACGCTCCCGAGGAGATGG + Intronic
1161801342 19:6418135-6418157 GGCCCGCACCCCCGAGGAGGTGG - Intronic
1162742848 19:12783152-12783174 GACTCAGGCCCCTGGGGAGGGGG + Intronic
1162809648 19:13156080-13156102 GTCCCGGGCCCCTGGGGAGGGGG + Intergenic
1163020794 19:14479927-14479949 GCCCCAGGCCCCTGAGGTGGGGG - Intronic
1163370009 19:16896618-16896640 TGCCGTGGCCCCTGAGGAGGGGG - Exonic
1165429531 19:35764704-35764726 GTCTCTCCTCCCTGAGGAGGAGG + Intronic
1165675511 19:37719388-37719410 CACCCTAGGGCCTGAGGAGGCGG + Exonic
1165685677 19:37817665-37817687 CACCCCCGGGCCTGAGGAGGCGG - Intergenic
1166215576 19:41332343-41332365 GACACACGCACCTGGGGAGGAGG - Intronic
927168581 2:20350322-20350344 GCCCCACGCCCCCGAGGCGGCGG + Intronic
927606553 2:24491467-24491489 GACCCCTGCTCCGGAGGAGGGGG + Intergenic
929559833 2:42949359-42949381 GGCCTACGCCCCTTAGGAGGTGG + Intergenic
932103875 2:68925587-68925609 GACCCTGGCCCATGAGTAAGTGG - Intergenic
932283551 2:70514705-70514727 CCTCCTCGCCCCTGAGGAGGGGG + Intronic
936096408 2:109533504-109533526 GAACCACGGGCCTGAGGAGGAGG + Intergenic
938270806 2:129969173-129969195 GACCCCCATCCCTGAGGGGGTGG - Intergenic
938344756 2:130559127-130559149 GACCCTCGGCACTGAGGAGGAGG - Intergenic
938345077 2:130561593-130561615 GACCCTCGGCACTGAGGAGGAGG + Intergenic
946397725 2:219451668-219451690 CACCCTCAGCCCGGAGGAGGAGG - Exonic
948838344 2:240636957-240636979 GGCTCGGGCCCCTGAGGAGGGGG - Intergenic
948884929 2:240877711-240877733 GACACTGGCTCCTGAGAAGGAGG + Intronic
948890544 2:240905145-240905167 GAATTTCGCCTCTGAGGAGGTGG + Intergenic
948907628 2:240987245-240987267 GTCCCTGGAGCCTGAGGAGGGGG + Intronic
1169030097 20:2400253-2400275 GACCCTGGCCCCTGAGAGAGGGG - Intronic
1169279386 20:4254181-4254203 GACTCTAGCCCCTAAAGAGGAGG + Intergenic
1172027007 20:31955394-31955416 GACTCTTGACCCTCAGGAGGAGG - Intergenic
1172540898 20:35715822-35715844 GACCCTCGCCTATTAGCAGGGGG - Intronic
1173146711 20:40530782-40530804 GACTCTCACCCTTGAGGAGTAGG - Intergenic
1174540511 20:51285686-51285708 GACCCTCGCTCCAGTGGTGGAGG + Intergenic
1175311027 20:58011653-58011675 GGCCGGGGCCCCTGAGGAGGTGG + Intergenic
1175904861 20:62374773-62374795 GCCCCTCGCCAGTGTGGAGGGGG + Intergenic
1179209721 21:39314212-39314234 GACCCGCGCTCCTGGGGCGGGGG + Intronic
1179881336 21:44294437-44294459 GACCCCAGCCCCTGTGGAGGGGG + Exonic
1181185967 22:21103894-21103916 GTCCCTCGCCCCTGGTCAGGCGG - Intergenic
1182259421 22:29062594-29062616 GAGCCTCCCTCCTGAGGGGGAGG + Intergenic
1182679565 22:32068204-32068226 GACCCTTGCCCTGGAGGAGGAGG - Intronic
1183214568 22:36471043-36471065 TTCCCTCGACCCTGAGGAGGCGG + Intronic
1183404807 22:37625183-37625205 GACCCTGGCCCCTTAAGATGGGG + Intronic
1183715681 22:39532330-39532352 GACCTGCGCCCCAGAGGAGGTGG - Intronic
1185279293 22:49963073-49963095 CACCCTCGACCCTGATGACGTGG + Exonic
1185290788 22:50026297-50026319 GACCCTCCCCTCTGAGGTGGCGG - Intronic
1185290796 22:50026352-50026374 GACCCTCCACTCTGAGGTGGTGG - Intronic
1185290807 22:50026407-50026429 GACCCTCCGCTCTGAGGTGGCGG - Intronic
1185290816 22:50026462-50026484 GACCCTCCACTCTGAGGTGGTGG - Intronic
1185290827 22:50026517-50026539 GACCCTCCGCTCTGAGGTGGCGG - Intronic
950000092 3:9649837-9649859 GTACCTCGCCGCTGAGGAAGAGG + Intronic
950515220 3:13460602-13460624 GGGCCTCTACCCTGAGGAGGAGG + Intergenic
950965661 3:17144084-17144106 GACCCTGGGCCCTGAGGCTGTGG - Intergenic
953909486 3:46884473-46884495 GACCCTGGCCCAGGAGGAGGAGG - Intronic
953981875 3:47417426-47417448 GTCCCAGGCCCCTGAGGACGAGG - Exonic
954453875 3:50586486-50586508 GACCCCAGCCCCTGGGAAGGGGG - Intergenic
956826017 3:72997206-72997228 GCTCCCCGCCCCTGGGGAGGTGG - Intronic
957039595 3:75327135-75327157 GCCCCTCTCCCCTGAGGCGTGGG - Intergenic
961467134 3:127088885-127088907 GTCCCTCGCCCACAAGGAGGCGG - Intergenic
962139293 3:132771788-132771810 GACCCACACCCCTGACGAGGAGG + Intergenic
967917657 3:194590702-194590724 CACCCTAGCCCCTGGGTAGGGGG + Intronic
968812072 4:2804637-2804659 GGCCCTGGCCTCTGTGGAGGGGG - Intronic
968883883 4:3317139-3317161 GAGCCTGGCCCAGGAGGAGGAGG + Exonic
968927592 4:3557908-3557930 GGCCCCTGCCCCTGGGGAGGTGG + Intergenic
969690135 4:8699642-8699664 GAGCCTCGGCCCTGAGGAGAGGG + Intergenic
985487515 5:159785-159807 GACCCTGGGCCCTGTGGAGCAGG + Intronic
985810022 5:2075866-2075888 GACCCTGGCCTGGGAGGAGGTGG + Intergenic
987679219 5:21113757-21113779 GTCCCTGGGCCTTGAGGAGGTGG + Intergenic
991270317 5:64771452-64771474 AACCCTAGCCCCTGAAGATGAGG + Intronic
992827421 5:80564597-80564619 GACCCTCTCCTCTGAGGACTGGG + Intronic
997990680 5:138542675-138542697 GACCCTCGCCCCTGGGTCAGGGG + Intronic
998164759 5:139836713-139836735 GACCCTGGCTCCTGGAGAGGAGG + Intronic
1000232849 5:159331644-159331666 GACCTCCGCCCCTGCGGTGGGGG + Intergenic
1001591583 5:172869180-172869202 GATCTTCCCCCCTGGGGAGGAGG + Intronic
1001710845 5:173776730-173776752 GCCCCTTGCCCCTGGGGAGTAGG + Intergenic
1002184491 5:177447673-177447695 GTGCCTCGGCCGTGAGGAGGAGG - Intronic
1002461473 5:179375960-179375982 GACTCCAGCCCCTGGGGAGGAGG + Intergenic
1002691333 5:181052881-181052903 GACCCTCCCGCCTGCGGACGCGG + Intronic
1005893495 6:30159098-30159120 GACACTGGACCCTGAGGAAGGGG + Intronic
1007699503 6:43758599-43758621 GCCCCTGGTCCCTGAGGAGGGGG - Intergenic
1013627039 6:111948924-111948946 GACCCTCTCCCTTGGGGAGGAGG + Intergenic
1017793897 6:157823871-157823893 GACCCTCGCCCCCGCGGGGCGGG + Intronic
1019500411 7:1361793-1361815 GTCCCTCCCTCCTGGGGAGGGGG - Intergenic
1019634898 7:2070287-2070309 GAGCCCCTCCCGTGAGGAGGTGG - Intronic
1019736309 7:2651389-2651411 CACCCTCGCCCCCGAGGACAAGG - Intronic
1020009539 7:4800555-4800577 GACACTCGCCCCTCTGGGGGCGG + Intronic
1020986872 7:15147114-15147136 CACCTTGGACCCTGAGGAGGAGG - Intergenic
1022306786 7:29154154-29154176 GACAGTTGCCCCTGGGGAGGAGG + Intronic
1023780401 7:43650133-43650155 GACCCTCGACCCTGAGCTGTCGG + Exonic
1024312222 7:47979662-47979684 GGGCCACGCCCCGGAGGAGGTGG + Intergenic
1025035971 7:55592669-55592691 GACCCTGGCCCCCCAGGAGAAGG + Intergenic
1027112603 7:75452819-75452841 CACCCTCTTCCCTGAAGAGGTGG + Intronic
1027284849 7:76637425-76637447 CACCCTCTTCCCTGAAGAGGTGG + Intergenic
1034560888 7:151878332-151878354 GACTCCCTCCCCAGAGGAGGAGG + Intergenic
1039912569 8:41836511-41836533 GTCCCCCTCCCCTGAGGTGGTGG + Intronic
1040065523 8:43141057-43141079 GGGCCTCGCCCCCGAGGACGTGG + Intronic
1048208059 8:132431405-132431427 GTCCCCCGACTCTGAGGAGGTGG - Intronic
1049645543 8:143734096-143734118 GACCCTCGCCCCGGAAGTCGGGG + Intergenic
1049856678 8:144866460-144866482 CACCCTCACCCCTGAGGACAGGG - Intergenic
1059725939 9:117008147-117008169 GTCCCTCACCCATGGGGAGGTGG + Exonic
1060261878 9:122082909-122082931 AACCCTCGCCCCCCAGGAGCTGG - Intronic
1061133539 9:128721207-128721229 GACCCTCTGGGCTGAGGAGGAGG - Exonic
1061832110 9:133302882-133302904 GACCCTGGCCCCTGGGGATCAGG + Intergenic
1062170967 9:135134391-135134413 GCGCCTCGCCCCTGGGGAGCAGG + Intergenic
1062524644 9:136973319-136973341 GGCCCACGCCCCTGAGATGGGGG - Intergenic
1186172796 X:6895086-6895108 GACTGTCGGTCCTGAGGAGGTGG + Intergenic
1187685688 X:21813604-21813626 GACCCAGACCTCTGAGGAGGGGG + Intergenic
1189539681 X:41972699-41972721 GACCCAGCCTCCTGAGGAGGGGG + Intergenic
1200982893 Y:9278335-9278357 GCCCTTCCACCCTGAGGAGGAGG - Intergenic