ID: 900230683

View in Genome Browser
Species Human (GRCh38)
Location 1:1555527-1555549
Sequence GAGTGTGCCACAAGCGTGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 69}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900230683 Original CRISPR GAGTGTGCCACAAGCGTGGA CGG Intronic
900211768 1:1459710-1459732 GGGTGGGCCCCAAGCCTGGAGGG - Intronic
900224577 1:1527010-1527032 GGGTGGGCCCCAAGCCTGGAGGG - Intronic
900230683 1:1555527-1555549 GAGTGTGCCACAAGCGTGGACGG + Intronic
900951912 1:5862981-5863003 GAGGGTCCCACATGCGTAGATGG + Exonic
902449069 1:16485200-16485222 GAGTGTCCCACTAGTGGGGATGG + Intergenic
903469429 1:23575566-23575588 GAGGGTGTCACAAGAGTGGAGGG - Intergenic
905804158 1:40863816-40863838 GAGAGTGTCAAATGCGTGGAGGG - Intergenic
914328928 1:146648142-146648164 GAGTGTGCCAGATGGGTTGATGG + Intergenic
918163731 1:181924862-181924884 GAGAGTGGCAAAAGTGTGGAGGG - Intergenic
921694360 1:218190627-218190649 GATTTTGCCACAAGGATGGATGG + Intergenic
922188291 1:223295485-223295507 GAGTGTGCCATAATAGAGGATGG + Intronic
1072523380 10:96249878-96249900 GAGTGTTCCACTGGCATGGAAGG + Intronic
1076469802 10:130710453-130710475 GAGTTTGCCACAGGCAGGGATGG + Intergenic
1081724934 11:45321476-45321498 GAGTGTGCTCCAAGGGAGGAGGG - Intergenic
1082013534 11:47467307-47467329 GATGGTGCCACAAGAGAGGAGGG + Intronic
1083053826 11:59800770-59800792 GAGTCAGCCACAAACCTGGAAGG - Intronic
1084177582 11:67431468-67431490 GAGTTTGCCACCAGTCTGGAAGG - Exonic
1096406598 12:51348416-51348438 GAGTGTGCCAGAATGCTGGAGGG - Intergenic
1098652901 12:72995976-72995998 AAGTGTGTCAAAAGCCTGGAAGG - Intergenic
1102610816 12:114110571-114110593 GAATGTGACAGAAGCATGGAAGG + Intergenic
1116065191 14:39973082-39973104 GAGGGTCCCACAAGCCTGGGTGG + Intergenic
1132555993 16:572902-572924 GAGTGTGGCTCCAGCGTGGGGGG + Intronic
1137023809 16:35454454-35454476 GAGTGAGCCAGAAGAGGGGAAGG + Intergenic
1138264786 16:55652603-55652625 GTGTTTGCTACAAGGGTGGAGGG - Intergenic
1140004638 16:71062801-71062823 GAGTGTGCCAGATGGGTTGATGG - Intronic
1141492861 16:84386590-84386612 GAGTGTGACACCAGCGAGCAAGG - Intronic
1141629260 16:85277813-85277835 GGGTCTGCCACAGGCATGGATGG - Intergenic
1142768920 17:2082621-2082643 GAATGTGCCACCAGCCTGGCAGG - Intronic
1148943457 17:51236604-51236626 AACTGTGCCACATGCTTGGAGGG - Intronic
1151828340 17:76535928-76535950 GAGTGTGCCAGACGCATGCAAGG + Intronic
1153812406 18:8763489-8763511 GAGTGTGACACAAGCTGGGCTGG - Intronic
1155846704 18:30716844-30716866 GAGTGTTCAACAAACGTGGAGGG - Intergenic
1166887755 19:45972356-45972378 GTGTGTGACACAGGCGTGGCTGG - Intronic
928429293 2:31204661-31204683 GAGGGTGCCACAACCAGGGAGGG + Intronic
930518161 2:52433205-52433227 GGTTATGCCGCAAGCGTGGAAGG - Intergenic
932194379 2:69770484-69770506 GAATGTGCCACAAGGCTGGCAGG + Intronic
933703176 2:85270608-85270630 GTGTCTGCCACAAGCACGGAGGG + Intronic
933940298 2:87239592-87239614 GAGTGTGTCAGCAGAGTGGAGGG + Intergenic
935657861 2:105440147-105440169 GGATGTGCCACAAATGTGGAAGG + Intergenic
936352840 2:111726184-111726206 GAGTGTGTCAGCAGAGTGGAGGG - Intergenic
937845497 2:126574405-126574427 GAGGATCCCACAAGAGTGGAAGG - Intergenic
940287882 2:152050244-152050266 CAGTGTGCCAAAAGGATGGAAGG - Intronic
946171951 2:217900785-217900807 GAGTGTGCCCTCAGTGTGGATGG - Intronic
946660857 2:221997922-221997944 GTGTGGGCTACAAGCATGGATGG + Intergenic
1176069151 20:63217001-63217023 GAGTTAGCCACAAGGGTGGCAGG - Intergenic
1176186408 20:63782339-63782361 GAGGGTGACAGAAGCGAGGATGG + Intronic
1180618794 22:17146286-17146308 GAGGGCGCCACAGGTGTGGAGGG - Intronic
1184970577 22:48017042-48017064 GAGTGAGCCACACGTGTGGGTGG - Intergenic
963674242 3:148288312-148288334 GAGTGTGGCACAGGCAGGGAGGG - Intergenic
965316725 3:167200815-167200837 AAGTGTGCCACAAAAGTGGAAGG + Intergenic
974616300 4:64287413-64287435 TAGCCTGCCAGAAGCGTGGAAGG + Intronic
977721572 4:100245137-100245159 GAGTGTGGCACACCCGGGGAAGG + Intergenic
979212332 4:118120272-118120294 GAGTGTGCCACAAGGATGCAGGG + Intronic
980586515 4:134823623-134823645 TAGAGAGCCACATGCGTGGAAGG - Intergenic
991488596 5:67163365-67163387 GAGTGTCCCAGAAGAGGGGATGG - Exonic
994187570 5:96832081-96832103 GAGTGTGCCAGAACCATGCAGGG + Intronic
995251438 5:109997462-109997484 GATTGTGCCTGAAGCATGGAAGG + Intergenic
1000707663 5:164531341-164531363 TTGTGTGCCACAAGTGTAGAAGG - Intergenic
1002963228 6:1937160-1937182 GAGTGTTCCACAAGCCTGGATGG - Intronic
1010323286 6:74538218-74538240 GGGTGTGCGATAAGGGTGGATGG + Intergenic
1018222909 6:161599205-161599227 CAATCTGCCACAAGCTTGGATGG - Intronic
1019078216 6:169408779-169408801 GCGTCTGCCACAGGCGAGGAAGG - Intergenic
1027141682 7:75662054-75662076 GAGTGAGCCACAAGGGGTGAAGG + Intronic
1028918546 7:96286406-96286428 CAGAGTGCCACAGGTGTGGAGGG - Intronic
1029927578 7:104333719-104333741 GAGGGTGCCACAAGATAGGATGG - Intronic
1031975281 7:128089749-128089771 GACTGTTCCACAAGCCAGGAAGG + Intronic
1035167574 7:157000542-157000564 GAGTGCGCCCCAGGCTTGGAGGG - Intronic
1037433193 8:18835823-18835845 GAGTGAGCAACAAGAGTGGGAGG + Intronic
1049215064 8:141404020-141404042 GAGTGTGCCCCGAGAGGGGATGG - Intronic
1049316258 8:141970210-141970232 GAGTGAGCCACAGGGGTGGGGGG - Intergenic
1049601095 8:143508037-143508059 GTGTGTGCCACATGGGTTGAGGG - Intronic
1057911272 9:99022160-99022182 GTGTGTGTGACAAGCCTGGATGG - Intronic
1060883912 9:127137265-127137287 GAGTGGGCCACTAGTCTGGAGGG - Intronic
1060886963 9:127161218-127161240 GGGTTTGCCACAACCGTGGATGG - Intronic
1061788695 9:133046714-133046736 GAGTGGGCCACACTGGTGGAAGG + Intronic
1186075649 X:5875298-5875320 GTGTGTCCCACAAGCCTGGAAGG + Intronic
1198800986 X:140447414-140447436 GAGTGGGGCAGAAGCATGGAAGG - Intergenic