ID: 900236583

View in Genome Browser
Species Human (GRCh38)
Location 1:1594466-1594488
Sequence AGACCCCTGGGGGTGTATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 133}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900236583_900236593 8 Left 900236583 1:1594466-1594488 CCAGGATACACCCCCAGGGGTCT 0: 1
1: 0
2: 0
3: 12
4: 133
Right 900236593 1:1594497-1594519 TCCGGCTGGGACGCGGCTCCAGG 0: 1
1: 0
2: 1
3: 10
4: 98
900236583_900236590 -6 Left 900236583 1:1594466-1594488 CCAGGATACACCCCCAGGGGTCT 0: 1
1: 0
2: 0
3: 12
4: 133
Right 900236590 1:1594483-1594505 GGGTCTCAGCAGGTTCCGGCTGG 0: 1
1: 0
2: 0
3: 12
4: 151
900236583_900236599 22 Left 900236583 1:1594466-1594488 CCAGGATACACCCCCAGGGGTCT 0: 1
1: 0
2: 0
3: 12
4: 133
Right 900236599 1:1594511-1594533 GGCTCCAGGGGTCTCGGCCCGGG 0: 1
1: 0
2: 2
3: 36
4: 235
900236583_900236600 23 Left 900236583 1:1594466-1594488 CCAGGATACACCCCCAGGGGTCT 0: 1
1: 0
2: 0
3: 12
4: 133
Right 900236600 1:1594512-1594534 GCTCCAGGGGTCTCGGCCCGGGG 0: 1
1: 0
2: 0
3: 12
4: 142
900236583_900236595 9 Left 900236583 1:1594466-1594488 CCAGGATACACCCCCAGGGGTCT 0: 1
1: 0
2: 0
3: 12
4: 133
Right 900236595 1:1594498-1594520 CCGGCTGGGACGCGGCTCCAGGG 0: 1
1: 0
2: 1
3: 12
4: 102
900236583_900236596 10 Left 900236583 1:1594466-1594488 CCAGGATACACCCCCAGGGGTCT 0: 1
1: 0
2: 0
3: 12
4: 133
Right 900236596 1:1594499-1594521 CGGCTGGGACGCGGCTCCAGGGG 0: 1
1: 0
2: 1
3: 8
4: 107
900236583_900236597 16 Left 900236583 1:1594466-1594488 CCAGGATACACCCCCAGGGGTCT 0: 1
1: 0
2: 0
3: 12
4: 133
Right 900236597 1:1594505-1594527 GGACGCGGCTCCAGGGGTCTCGG 0: 2
1: 0
2: 1
3: 16
4: 128
900236583_900236589 -10 Left 900236583 1:1594466-1594488 CCAGGATACACCCCCAGGGGTCT 0: 1
1: 0
2: 0
3: 12
4: 133
Right 900236589 1:1594479-1594501 CCAGGGGTCTCAGCAGGTTCCGG 0: 1
1: 0
2: 3
3: 30
4: 234
900236583_900236598 21 Left 900236583 1:1594466-1594488 CCAGGATACACCCCCAGGGGTCT 0: 1
1: 0
2: 0
3: 12
4: 133
Right 900236598 1:1594510-1594532 CGGCTCCAGGGGTCTCGGCCCGG 0: 1
1: 1
2: 0
3: 13
4: 144
900236583_900236591 -5 Left 900236583 1:1594466-1594488 CCAGGATACACCCCCAGGGGTCT 0: 1
1: 0
2: 0
3: 12
4: 133
Right 900236591 1:1594484-1594506 GGTCTCAGCAGGTTCCGGCTGGG 0: 1
1: 0
2: 1
3: 9
4: 90
900236583_900236592 1 Left 900236583 1:1594466-1594488 CCAGGATACACCCCCAGGGGTCT 0: 1
1: 0
2: 0
3: 12
4: 133
Right 900236592 1:1594490-1594512 AGCAGGTTCCGGCTGGGACGCGG 0: 1
1: 0
2: 1
3: 13
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900236583 Original CRISPR AGACCCCTGGGGGTGTATCC TGG (reversed) Intergenic