ID: 900236585

View in Genome Browser
Species Human (GRCh38)
Location 1:1594476-1594498
Sequence GAACCTGCTGAGACCCCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 212}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900236585_900236593 -2 Left 900236585 1:1594476-1594498 CCCCCAGGGGTCTCAGCAGGTTC 0: 1
1: 0
2: 0
3: 21
4: 212
Right 900236593 1:1594497-1594519 TCCGGCTGGGACGCGGCTCCAGG 0: 1
1: 0
2: 1
3: 10
4: 98
900236585_900236600 13 Left 900236585 1:1594476-1594498 CCCCCAGGGGTCTCAGCAGGTTC 0: 1
1: 0
2: 0
3: 21
4: 212
Right 900236600 1:1594512-1594534 GCTCCAGGGGTCTCGGCCCGGGG 0: 1
1: 0
2: 0
3: 12
4: 142
900236585_900236596 0 Left 900236585 1:1594476-1594498 CCCCCAGGGGTCTCAGCAGGTTC 0: 1
1: 0
2: 0
3: 21
4: 212
Right 900236596 1:1594499-1594521 CGGCTGGGACGCGGCTCCAGGGG 0: 1
1: 0
2: 1
3: 8
4: 107
900236585_900236595 -1 Left 900236585 1:1594476-1594498 CCCCCAGGGGTCTCAGCAGGTTC 0: 1
1: 0
2: 0
3: 21
4: 212
Right 900236595 1:1594498-1594520 CCGGCTGGGACGCGGCTCCAGGG 0: 1
1: 0
2: 1
3: 12
4: 102
900236585_900236599 12 Left 900236585 1:1594476-1594498 CCCCCAGGGGTCTCAGCAGGTTC 0: 1
1: 0
2: 0
3: 21
4: 212
Right 900236599 1:1594511-1594533 GGCTCCAGGGGTCTCGGCCCGGG 0: 1
1: 0
2: 2
3: 36
4: 235
900236585_900236597 6 Left 900236585 1:1594476-1594498 CCCCCAGGGGTCTCAGCAGGTTC 0: 1
1: 0
2: 0
3: 21
4: 212
Right 900236597 1:1594505-1594527 GGACGCGGCTCCAGGGGTCTCGG 0: 2
1: 0
2: 1
3: 16
4: 128
900236585_900236598 11 Left 900236585 1:1594476-1594498 CCCCCAGGGGTCTCAGCAGGTTC 0: 1
1: 0
2: 0
3: 21
4: 212
Right 900236598 1:1594510-1594532 CGGCTCCAGGGGTCTCGGCCCGG 0: 1
1: 1
2: 0
3: 13
4: 144
900236585_900236592 -9 Left 900236585 1:1594476-1594498 CCCCCAGGGGTCTCAGCAGGTTC 0: 1
1: 0
2: 0
3: 21
4: 212
Right 900236592 1:1594490-1594512 AGCAGGTTCCGGCTGGGACGCGG 0: 1
1: 0
2: 1
3: 13
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900236585 Original CRISPR GAACCTGCTGAGACCCCTGG GGG (reversed) Intergenic