ID: 900236588

View in Genome Browser
Species Human (GRCh38)
Location 1:1594479-1594501
Sequence CCGGAACCTGCTGAGACCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 163}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900236588_900236593 -5 Left 900236588 1:1594479-1594501 CCAGGGGTCTCAGCAGGTTCCGG 0: 1
1: 0
2: 0
3: 11
4: 163
Right 900236593 1:1594497-1594519 TCCGGCTGGGACGCGGCTCCAGG 0: 1
1: 0
2: 1
3: 10
4: 98
900236588_900236596 -3 Left 900236588 1:1594479-1594501 CCAGGGGTCTCAGCAGGTTCCGG 0: 1
1: 0
2: 0
3: 11
4: 163
Right 900236596 1:1594499-1594521 CGGCTGGGACGCGGCTCCAGGGG 0: 1
1: 0
2: 1
3: 8
4: 107
900236588_900236597 3 Left 900236588 1:1594479-1594501 CCAGGGGTCTCAGCAGGTTCCGG 0: 1
1: 0
2: 0
3: 11
4: 163
Right 900236597 1:1594505-1594527 GGACGCGGCTCCAGGGGTCTCGG 0: 2
1: 0
2: 1
3: 16
4: 128
900236588_900236595 -4 Left 900236588 1:1594479-1594501 CCAGGGGTCTCAGCAGGTTCCGG 0: 1
1: 0
2: 0
3: 11
4: 163
Right 900236595 1:1594498-1594520 CCGGCTGGGACGCGGCTCCAGGG 0: 1
1: 0
2: 1
3: 12
4: 102
900236588_900236599 9 Left 900236588 1:1594479-1594501 CCAGGGGTCTCAGCAGGTTCCGG 0: 1
1: 0
2: 0
3: 11
4: 163
Right 900236599 1:1594511-1594533 GGCTCCAGGGGTCTCGGCCCGGG 0: 1
1: 0
2: 2
3: 36
4: 235
900236588_900236600 10 Left 900236588 1:1594479-1594501 CCAGGGGTCTCAGCAGGTTCCGG 0: 1
1: 0
2: 0
3: 11
4: 163
Right 900236600 1:1594512-1594534 GCTCCAGGGGTCTCGGCCCGGGG 0: 1
1: 0
2: 0
3: 12
4: 142
900236588_900236598 8 Left 900236588 1:1594479-1594501 CCAGGGGTCTCAGCAGGTTCCGG 0: 1
1: 0
2: 0
3: 11
4: 163
Right 900236598 1:1594510-1594532 CGGCTCCAGGGGTCTCGGCCCGG 0: 1
1: 1
2: 0
3: 13
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900236588 Original CRISPR CCGGAACCTGCTGAGACCCC TGG (reversed) Intergenic