ID: 900236593

View in Genome Browser
Species Human (GRCh38)
Location 1:1594497-1594519
Sequence TCCGGCTGGGACGCGGCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 98}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900236588_900236593 -5 Left 900236588 1:1594479-1594501 CCAGGGGTCTCAGCAGGTTCCGG 0: 1
1: 0
2: 0
3: 11
4: 163
Right 900236593 1:1594497-1594519 TCCGGCTGGGACGCGGCTCCAGG 0: 1
1: 0
2: 1
3: 10
4: 98
900236586_900236593 -3 Left 900236586 1:1594477-1594499 CCCCAGGGGTCTCAGCAGGTTCC 0: 1
1: 0
2: 1
3: 22
4: 205
Right 900236593 1:1594497-1594519 TCCGGCTGGGACGCGGCTCCAGG 0: 1
1: 0
2: 1
3: 10
4: 98
900236587_900236593 -4 Left 900236587 1:1594478-1594500 CCCAGGGGTCTCAGCAGGTTCCG 0: 1
1: 0
2: 0
3: 3
4: 117
Right 900236593 1:1594497-1594519 TCCGGCTGGGACGCGGCTCCAGG 0: 1
1: 0
2: 1
3: 10
4: 98
900236583_900236593 8 Left 900236583 1:1594466-1594488 CCAGGATACACCCCCAGGGGTCT 0: 1
1: 0
2: 0
3: 12
4: 133
Right 900236593 1:1594497-1594519 TCCGGCTGGGACGCGGCTCCAGG 0: 1
1: 0
2: 1
3: 10
4: 98
900236585_900236593 -2 Left 900236585 1:1594476-1594498 CCCCCAGGGGTCTCAGCAGGTTC 0: 1
1: 0
2: 0
3: 21
4: 212
Right 900236593 1:1594497-1594519 TCCGGCTGGGACGCGGCTCCAGG 0: 1
1: 0
2: 1
3: 10
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900236593 Original CRISPR TCCGGCTGGGACGCGGCTCC AGG Intergenic