ID: 900236599

View in Genome Browser
Species Human (GRCh38)
Location 1:1594511-1594533
Sequence GGCTCCAGGGGTCTCGGCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 235}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900236588_900236599 9 Left 900236588 1:1594479-1594501 CCAGGGGTCTCAGCAGGTTCCGG 0: 1
1: 0
2: 0
3: 11
4: 163
Right 900236599 1:1594511-1594533 GGCTCCAGGGGTCTCGGCCCGGG 0: 1
1: 0
2: 2
3: 36
4: 235
900236583_900236599 22 Left 900236583 1:1594466-1594488 CCAGGATACACCCCCAGGGGTCT 0: 1
1: 0
2: 0
3: 12
4: 133
Right 900236599 1:1594511-1594533 GGCTCCAGGGGTCTCGGCCCGGG 0: 1
1: 0
2: 2
3: 36
4: 235
900236587_900236599 10 Left 900236587 1:1594478-1594500 CCCAGGGGTCTCAGCAGGTTCCG 0: 1
1: 0
2: 0
3: 3
4: 117
Right 900236599 1:1594511-1594533 GGCTCCAGGGGTCTCGGCCCGGG 0: 1
1: 0
2: 2
3: 36
4: 235
900236594_900236599 -10 Left 900236594 1:1594498-1594520 CCGGCTGGGACGCGGCTCCAGGG 0: 1
1: 0
2: 1
3: 16
4: 173
Right 900236599 1:1594511-1594533 GGCTCCAGGGGTCTCGGCCCGGG 0: 1
1: 0
2: 2
3: 36
4: 235
900236585_900236599 12 Left 900236585 1:1594476-1594498 CCCCCAGGGGTCTCAGCAGGTTC 0: 1
1: 0
2: 0
3: 21
4: 212
Right 900236599 1:1594511-1594533 GGCTCCAGGGGTCTCGGCCCGGG 0: 1
1: 0
2: 2
3: 36
4: 235
900236586_900236599 11 Left 900236586 1:1594477-1594499 CCCCAGGGGTCTCAGCAGGTTCC 0: 1
1: 0
2: 1
3: 22
4: 205
Right 900236599 1:1594511-1594533 GGCTCCAGGGGTCTCGGCCCGGG 0: 1
1: 0
2: 2
3: 36
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900236599 Original CRISPR GGCTCCAGGGGTCTCGGCCC GGG Intergenic