ID: 900236600

View in Genome Browser
Species Human (GRCh38)
Location 1:1594512-1594534
Sequence GCTCCAGGGGTCTCGGCCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 142}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900236588_900236600 10 Left 900236588 1:1594479-1594501 CCAGGGGTCTCAGCAGGTTCCGG 0: 1
1: 0
2: 0
3: 11
4: 163
Right 900236600 1:1594512-1594534 GCTCCAGGGGTCTCGGCCCGGGG 0: 1
1: 0
2: 0
3: 12
4: 142
900236586_900236600 12 Left 900236586 1:1594477-1594499 CCCCAGGGGTCTCAGCAGGTTCC 0: 1
1: 0
2: 1
3: 22
4: 205
Right 900236600 1:1594512-1594534 GCTCCAGGGGTCTCGGCCCGGGG 0: 1
1: 0
2: 0
3: 12
4: 142
900236583_900236600 23 Left 900236583 1:1594466-1594488 CCAGGATACACCCCCAGGGGTCT 0: 1
1: 0
2: 0
3: 12
4: 133
Right 900236600 1:1594512-1594534 GCTCCAGGGGTCTCGGCCCGGGG 0: 1
1: 0
2: 0
3: 12
4: 142
900236585_900236600 13 Left 900236585 1:1594476-1594498 CCCCCAGGGGTCTCAGCAGGTTC 0: 1
1: 0
2: 0
3: 21
4: 212
Right 900236600 1:1594512-1594534 GCTCCAGGGGTCTCGGCCCGGGG 0: 1
1: 0
2: 0
3: 12
4: 142
900236594_900236600 -9 Left 900236594 1:1594498-1594520 CCGGCTGGGACGCGGCTCCAGGG 0: 1
1: 0
2: 1
3: 16
4: 173
Right 900236600 1:1594512-1594534 GCTCCAGGGGTCTCGGCCCGGGG 0: 1
1: 0
2: 0
3: 12
4: 142
900236587_900236600 11 Left 900236587 1:1594478-1594500 CCCAGGGGTCTCAGCAGGTTCCG 0: 1
1: 0
2: 0
3: 3
4: 117
Right 900236600 1:1594512-1594534 GCTCCAGGGGTCTCGGCCCGGGG 0: 1
1: 0
2: 0
3: 12
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900236600 Original CRISPR GCTCCAGGGGTCTCGGCCCG GGG Intergenic