ID: 900237289

View in Genome Browser
Species Human (GRCh38)
Location 1:1598875-1598897
Sequence TAACCTAAGCCCAGTGGGGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 122}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900237281_900237289 11 Left 900237281 1:1598841-1598863 CCTGCAGTGGGCCCGAGATACTA 0: 1
1: 0
2: 0
3: 6
4: 56
Right 900237289 1:1598875-1598897 TAACCTAAGCCCAGTGGGGTGGG 0: 1
1: 0
2: 1
3: 7
4: 122
900237283_900237289 0 Left 900237283 1:1598852-1598874 CCCGAGATACTAAGGCACGAAGC 0: 1
1: 0
2: 0
3: 1
4: 58
Right 900237289 1:1598875-1598897 TAACCTAAGCCCAGTGGGGTGGG 0: 1
1: 0
2: 1
3: 7
4: 122
900237284_900237289 -1 Left 900237284 1:1598853-1598875 CCGAGATACTAAGGCACGAAGCT 0: 1
1: 0
2: 0
3: 7
4: 71
Right 900237289 1:1598875-1598897 TAACCTAAGCCCAGTGGGGTGGG 0: 1
1: 0
2: 1
3: 7
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900237289 Original CRISPR TAACCTAAGCCCAGTGGGGT GGG Exonic
900237289 1:1598875-1598897 TAACCTAAGCCCAGTGGGGTGGG + Exonic
903229556 1:21913555-21913577 TAACCTAAGGCCTGGGGGTTGGG - Intronic
907626171 1:56032347-56032369 TGATCTAGGCCCAGTGGGATTGG - Intergenic
909186332 1:72491212-72491234 AAACTTATGCCCAGAGGGGTGGG + Intergenic
911758507 1:101588859-101588881 TACCCTCAGCCCAGTGGAGAAGG - Intergenic
920378715 1:205523374-205523396 TCCCCTAAGGCCAGTGGGGAGGG - Intronic
920435303 1:205943322-205943344 TGACCCCAGCCCAGTGGGGTGGG + Intronic
922503585 1:226114037-226114059 TCGCTTGAGCCCAGTGGGGTGGG - Intergenic
922960135 1:229639208-229639230 TCACCTGAGCCCAGGGAGGTCGG + Intronic
1064935482 10:20674248-20674270 TGTCCTCAACCCAGTGGGGTTGG - Intergenic
1065181794 10:23133685-23133707 TTACCTAAGGCCAGTTGGGGTGG + Intergenic
1065938246 10:30540704-30540726 TCAGCTGAGCCCAGTGGGATGGG + Intergenic
1066072953 10:31838915-31838937 TCACCTAAGCCTGGTGGGGGAGG + Intronic
1068338234 10:55666338-55666360 TAACCTAAGCTCAGTTGAATGGG + Intergenic
1070690686 10:78522679-78522701 TAAGCAAAGCCCTGTGGGGAAGG + Intergenic
1072345279 10:94498852-94498874 TCACCTGAGCCCAGGGAGGTCGG - Intronic
1072973656 10:100038901-100038923 GAAGCCAAGGCCAGTGGGGTAGG - Intergenic
1073127290 10:101159279-101159301 TAAACTCAGCCAAGTGGGGCAGG - Intergenic
1076803033 10:132841323-132841345 TCACATCAGCCCTGTGGGGTTGG - Intronic
1077449163 11:2625338-2625360 TAGCCTAAGCCCAGAGGTCTAGG - Intronic
1079080565 11:17410798-17410820 TAACCAAGGCCCAGAGAGGTTGG - Intronic
1083589302 11:63883667-63883689 TCACCTGAGCCCAGGGAGGTAGG - Intronic
1084287388 11:68141029-68141051 TCACATTAGCCCTGTGGGGTGGG + Intergenic
1084657700 11:70528759-70528781 TCACCTACGCCAAGTGGGGGAGG + Intronic
1085070091 11:73535928-73535950 TCACCTGAGCCCAGGGAGGTTGG - Intronic
1088522383 11:110712900-110712922 CACCCTATCCCCAGTGGGGTGGG - Intronic
1089841944 11:121426126-121426148 TAAACAAAACCCAGTGGGGCTGG - Intergenic
1095987277 12:48007378-48007400 TAGCCGAAGGTCAGTGGGGTAGG + Intergenic
1096539431 12:52296677-52296699 TGACCTCAGGCCAGTTGGGTGGG - Intronic
1101702235 12:107184972-107184994 TAAAATAAGACCAGTAGGGTGGG + Intergenic
1101771620 12:107756931-107756953 GAACCTGAGTCCAGTGGGGATGG - Exonic
1104766903 12:131335995-131336017 TGCCCCAAGCCCAGTGGGTTGGG + Intergenic
1105525065 13:21169719-21169741 TCACCTGAGCCCAGTGTTGTGGG - Intronic
1106521271 13:30499839-30499861 TAACCAAATCCCAGTGGCTTGGG - Intronic
1113644995 13:111988403-111988425 TATCCTAAGCACACTGGGGCAGG - Intergenic
1117660764 14:58001902-58001924 TAAACTCAGTCCAGTGGGGATGG + Exonic
1117954713 14:61113571-61113593 TAAACAAAGCCCAGTGGTGAGGG - Intergenic
1120355560 14:83428903-83428925 TAAGCTAAGGCCAGTAGGATTGG - Intergenic
1121513831 14:94535718-94535740 TCACCACAGCCCTGTGGGGTAGG + Intergenic
1121727225 14:96161516-96161538 TAATCCTAGCCCAGTGCGGTAGG + Intergenic
1122230494 14:100304413-100304435 AAACCTAGGCCCAGAGAGGTGGG - Intronic
1123061708 14:105597522-105597544 GAACCTGAGCCCAGAGGGGCCGG - Intergenic
1125217273 15:37289690-37289712 AAACCTAACCCCAGTGGTGATGG - Intergenic
1133767222 16:8846520-8846542 TAACGTGAGCCCAGTGGGATTGG + Intronic
1134636814 16:15798975-15798997 TAACCTAATCTGGGTGGGGTGGG - Intronic
1134657095 16:15955269-15955291 TCGCTTGAGCCCAGTGGGGTTGG + Intronic
1134668066 16:16034110-16034132 TCACCTAAGCCCAGTAGATTGGG - Intronic
1136079862 16:27844863-27844885 GCAGCTCAGCCCAGTGGGGTGGG - Intronic
1138279348 16:55761180-55761202 TCACCAAAGCCCAGTGAGGTAGG - Intergenic
1138289180 16:55832495-55832517 TCACCAAAGCCCAGTGAGGTAGG + Intronic
1142179158 16:88658893-88658915 GAGCCTGAGCTCAGTGGGGTGGG - Intronic
1144584917 17:16482178-16482200 GAAACTAAGGGCAGTGGGGTGGG + Intronic
1146592539 17:34140179-34140201 GAACAGAAGCCCAGTGGGATAGG + Intronic
1152291865 17:79444347-79444369 CACCCTGAGCCCAGTGAGGTTGG + Intronic
1152305175 17:79516229-79516251 TATCTTAAGCCCCGTGGGGATGG - Intergenic
1158235936 18:55314028-55314050 TTCCCTAAGCCAAATGGGGTGGG - Intronic
1160748575 19:722999-723021 AAACCAAACCCGAGTGGGGTGGG + Intronic
1161236090 19:3198922-3198944 GAATCCAAGCCCTGTGGGGTGGG - Intronic
1162401692 19:10450653-10450675 GTAGCTAAGCCCAGAGGGGTGGG + Intronic
1164597725 19:29541182-29541204 TATCCTAAGAGCAGTGGGATGGG + Intronic
1165049620 19:33133003-33133025 TAAACTTAGCCCAGTGTGATGGG + Intronic
929632794 2:43482522-43482544 AAACCAAAGCCCAGAGAGGTTGG + Intronic
929947777 2:46383305-46383327 TGAACCAAGTCCAGTGGGGTGGG - Intronic
930251718 2:49042057-49042079 TCACCTAAGCCCAGGGATGTTGG + Intronic
931462729 2:62462483-62462505 TCACCTTAGCCCAGTGGGGAGGG - Intergenic
934102509 2:88666566-88666588 TAACCTTACCCCAGTGAGGATGG + Intergenic
936154098 2:110037126-110037148 TGCCCTGAGCCCACTGGGGTAGG - Intergenic
936190586 2:110334289-110334311 TGCCCTGAGCCCACTGGGGTAGG + Intergenic
936393287 2:112096068-112096090 TTACCTAAGTCCAGTGGGGAAGG - Intronic
936896530 2:117434149-117434171 TCACCTAACCCCAGTGGAGCAGG + Intergenic
940555067 2:155214861-155214883 TAGCCTAAGCTTAGTGGGTTCGG + Intergenic
941675473 2:168339327-168339349 CAGCACAAGCCCAGTGGGGTAGG + Intergenic
947729521 2:232420249-232420271 TAGCCAAGGCCAAGTGGGGTGGG + Intergenic
1169831561 20:9831038-9831060 TATCCCATGCCCAGTGGGCTGGG + Intronic
1172122285 20:32605555-32605577 AAACCTCAGCCCAGCGAGGTGGG - Intronic
1178526164 21:33331178-33331200 TAGCCCAAGGGCAGTGGGGTAGG - Intronic
1178833465 21:36075892-36075914 TAACTTAATTCCAGTGTGGTCGG - Intronic
1181712526 22:24699579-24699601 TCACATGAGCCCTGTGGGGTGGG + Intergenic
1182378844 22:29870036-29870058 TACTCTGAGCCCAGTGGTGTGGG - Intergenic
1184964780 22:47963383-47963405 TAATCAAAGCCCAGCGGAGTTGG + Intergenic
951822185 3:26825685-26825707 TGAGCTAGGCCCAGTGGGGTTGG + Intergenic
952173487 3:30835675-30835697 TAATATGAGGCCAGTGGGGTTGG - Intronic
953822928 3:46223896-46223918 AAACATAAGCCCAGAGGTGTCGG + Intronic
954695921 3:52426037-52426059 TTACCTGAGCCCAGGGAGGTCGG - Intergenic
954994576 3:54869975-54869997 AAACCTAAGAGTAGTGGGGTGGG + Intronic
969082891 4:4633409-4633431 TACCCCAAGCTCAGTGGGGAAGG - Intergenic
970176912 4:13348823-13348845 GAAGCTAAGCCCAGGGAGGTGGG + Intergenic
971754935 4:30695403-30695425 TAACCTGGGCCCAGTGCAGTGGG + Intergenic
972653852 4:41047438-41047460 TAACCAAAGCCCACAGGGATAGG + Intronic
974443435 4:61948583-61948605 GGACCAAAGGCCAGTGGGGTTGG + Intronic
979899020 4:126194054-126194076 TGATATAAGCCCAGTGTGGTGGG - Intergenic
981748983 4:148075420-148075442 TAAGCTGAGCACAGTAGGGTTGG + Intergenic
987455566 5:18141264-18141286 TAACATAAGACCAGTGGGGTAGG - Intergenic
996915203 5:128703606-128703628 CATCCTAAGCACACTGGGGTAGG - Intronic
998291828 5:140923441-140923463 TCACCTGAGCCCAGAGAGGTAGG + Intronic
1000165281 5:158642421-158642443 TAAACTAAGCCTTGTGGGGCAGG + Intergenic
1002427456 5:179184736-179184758 CAGCCTCAGCCCAGTGGGGAAGG - Intronic
1003254556 6:4463371-4463393 TAGCAAAAGCCCAGTGAGGTAGG - Intergenic
1004996964 6:21202973-21202995 TAGCATGAGGCCAGTGGGGTAGG + Intronic
1005707235 6:28468019-28468041 AAACCTTAGCCCTGTGGGTTAGG - Intergenic
1007749400 6:44062884-44062906 GAAGCTCAGCCCATTGGGGTAGG - Intergenic
1007800319 6:44386853-44386875 TAACTAAAACCCAGTGAGGTAGG - Intergenic
1010554684 6:77264873-77264895 TAACCTACTGGCAGTGGGGTTGG + Intergenic
1012801966 6:103842013-103842035 TCACCTGAGCCCAGAGAGGTCGG - Intergenic
1018667224 6:166149711-166149733 CAACATCTGCCCAGTGGGGTTGG - Intergenic
1019686481 7:2384760-2384782 GAAACTGGGCCCAGTGGGGTGGG - Intergenic
1024604039 7:51010489-51010511 TGACCAAAGCCCAGGTGGGTCGG - Intergenic
1029022449 7:97379039-97379061 GAACCTAAGCACAGTTTGGTTGG - Intergenic
1029936627 7:104431978-104432000 AGCCCAAAGCCCAGTGGGGTAGG - Intronic
1029944964 7:104522746-104522768 GAAGCTAAGCCCACTGGGGAAGG + Intronic
1031976458 7:128096864-128096886 TACCCCAATCCCCGTGGGGTGGG + Intergenic
1033515932 7:142106052-142106074 AAACCTTAGCCCTGTGGGATAGG + Exonic
1035101416 7:156400551-156400573 TAGCCTCAGCCCAGTGAGGCAGG - Intergenic
1035398974 7:158552303-158552325 TAACCACACCCCATTGGGGTGGG + Intronic
1036771124 8:11578975-11578997 TCACCACAGCCCAGCGGGGTGGG - Intergenic
1039554214 8:38465562-38465584 TATCCTACCCCCAGTGGGTTAGG - Intronic
1042242742 8:66681073-66681095 TAGCCTGAGCCCAGGGGAGTTGG + Exonic
1046855344 8:119025459-119025481 TGACCTAAGGCCACAGGGGTGGG - Intronic
1050459393 9:5864505-5864527 TAACCTCACCCCCGTGGGGAGGG + Intergenic
1050583598 9:7086553-7086575 TTACCTAAGGGCAGTGTGGTAGG - Intergenic
1051898504 9:22013173-22013195 TAAAATAAGGCCATTGGGGTGGG - Intronic
1055709179 9:79039942-79039964 TAACCCAAGCCCAGTGATTTGGG + Intergenic
1057904830 9:98975390-98975412 AAACCGAGGCCCAGCGGGGTAGG + Intronic
1058880787 9:109284562-109284584 TAAAATTAGCCCAGTGTGGTGGG - Intronic
1060382196 9:123186261-123186283 TCACTTGAGCCCAGTAGGGTGGG + Intronic
1060784391 9:126438694-126438716 TTCCCAGAGCCCAGTGGGGTGGG + Intronic
1186368927 X:8926722-8926744 TAATCTAAGCCCAATAGGGAAGG + Intergenic
1189487187 X:41442819-41442841 AAACCCCAGCTCAGTGGGGTTGG - Intergenic
1190969453 X:55334634-55334656 TAACCCAAGGCCACTGAGGTTGG - Intergenic
1198316712 X:135474697-135474719 TAACTTAAGGCCAGTTGGGGAGG - Intergenic
1199794657 X:151182589-151182611 GAACCTTAGCCAAGTGTGGTGGG - Intergenic