ID: 900237398

View in Genome Browser
Species Human (GRCh38)
Location 1:1599317-1599339
Sequence GGCGGGCGGCCTCGCGCTTC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 79}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900237391_900237398 2 Left 900237391 1:1599292-1599314 CCCTCAGGCAGGTGGCGCAAAGA 0: 1
1: 0
2: 0
3: 5
4: 87
Right 900237398 1:1599317-1599339 GGCGGGCGGCCTCGCGCTTCAGG 0: 1
1: 0
2: 2
3: 10
4: 79
900237392_900237398 1 Left 900237392 1:1599293-1599315 CCTCAGGCAGGTGGCGCAAAGAT 0: 1
1: 0
2: 0
3: 6
4: 108
Right 900237398 1:1599317-1599339 GGCGGGCGGCCTCGCGCTTCAGG 0: 1
1: 0
2: 2
3: 10
4: 79
900237387_900237398 18 Left 900237387 1:1599276-1599298 CCTGGGAGCTCAGGCGCCCTCAG 0: 1
1: 0
2: 1
3: 20
4: 236
Right 900237398 1:1599317-1599339 GGCGGGCGGCCTCGCGCTTCAGG 0: 1
1: 0
2: 2
3: 10
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900237398 Original CRISPR GGCGGGCGGCCTCGCGCTTC AGG Exonic