ID: 900237398

View in Genome Browser
Species Human (GRCh38)
Location 1:1599317-1599339
Sequence GGCGGGCGGCCTCGCGCTTC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 79}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900237387_900237398 18 Left 900237387 1:1599276-1599298 CCTGGGAGCTCAGGCGCCCTCAG 0: 1
1: 0
2: 1
3: 20
4: 236
Right 900237398 1:1599317-1599339 GGCGGGCGGCCTCGCGCTTCAGG 0: 1
1: 0
2: 2
3: 10
4: 79
900237392_900237398 1 Left 900237392 1:1599293-1599315 CCTCAGGCAGGTGGCGCAAAGAT 0: 1
1: 0
2: 0
3: 6
4: 108
Right 900237398 1:1599317-1599339 GGCGGGCGGCCTCGCGCTTCAGG 0: 1
1: 0
2: 2
3: 10
4: 79
900237391_900237398 2 Left 900237391 1:1599292-1599314 CCCTCAGGCAGGTGGCGCAAAGA 0: 1
1: 0
2: 0
3: 5
4: 87
Right 900237398 1:1599317-1599339 GGCGGGCGGCCTCGCGCTTCAGG 0: 1
1: 0
2: 2
3: 10
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900237398 Original CRISPR GGCGGGCGGCCTCGCGCTTC AGG Exonic
900237398 1:1599317-1599339 GGCGGGCGGCCTCGCGCTTCAGG + Exonic
902990815 1:20186048-20186070 GGTGGGGGGCCACGTGCTTCCGG - Intergenic
905584250 1:39105091-39105113 GGTGGGAGGCCCCGCGCGTCAGG - Intronic
909643219 1:77889025-77889047 GTCGGCCGGCCTTGGGCTTCTGG + Intronic
922505033 1:226121528-226121550 GGGGGGGGGCCTGGCGCTGCTGG - Intergenic
924707871 1:246513149-246513171 GGTGGGAGGCCTCGGGGTTCGGG - Intergenic
1064033072 10:11895019-11895041 GGCGGGCCTCCTCCCCCTTCTGG - Intergenic
1064397949 10:14996272-14996294 GGCGGGAGCCCACGCGATTCGGG - Intergenic
1066114409 10:32226891-32226913 GGCGGGAGGCCTCTTGCTTGAGG - Intergenic
1073136776 10:101224643-101224665 GGCGGGCGGCCTGGGGCTTCGGG + Intergenic
1077021004 11:417148-417170 CGCGGGCGAGCTCGGGCTTCCGG + Intronic
1077043880 11:535927-535949 GGTGGGCGGCGCCGCGCTGCCGG - Intronic
1077049075 11:558657-558679 GCCGGGCGTCCTCGCCATTCTGG + Exonic
1077133242 11:985437-985459 GTCAGGCGGCCTCGCACTGCAGG - Exonic
1077337615 11:2012469-2012491 GGCGGCCGGCTCCGGGCTTCAGG - Intergenic
1083232692 11:61333163-61333185 GGTTGGCGGCCTCGGGCTTCGGG - Exonic
1083665415 11:64271562-64271584 GGGGGGCGGCCTGGTACTTCAGG + Intronic
1084889741 11:72230792-72230814 GGCAGAAGGCCTCCCGCTTCTGG - Exonic
1088722739 11:112608860-112608882 GGGGGGCTGCTTCCCGCTTCGGG + Intergenic
1202820599 11_KI270721v1_random:67651-67673 GGCGGCCGGCTCCGGGCTTCAGG - Intergenic
1092108892 12:5945239-5945261 GGCCCGCGGCCGCGCGCTTCTGG + Exonic
1092226046 12:6748930-6748952 GGCGGGAGACCTCCCGATTCCGG - Exonic
1096271187 12:50167390-50167412 GGCCGGCGGCCACCCCCTTCCGG + Exonic
1097218257 12:57430805-57430827 GGCCGGCGGCGGCGCGCTTCTGG + Exonic
1103393212 12:120589119-120589141 GGCGGGCGGCCTCCCAGTTCGGG + Intergenic
1105019784 12:132808381-132808403 GGTGGGCAGCCTGGGGCTTCCGG - Exonic
1119382831 14:74239777-74239799 GGTGGGCGGCATGGGGCTTCTGG + Exonic
1121546655 14:94768290-94768312 CGCGGGCGGCCTCGGGCTGCTGG + Exonic
1122582234 14:102777869-102777891 GCCGGGCTGCCTCCCGCCTCCGG + Intronic
1122688614 14:103521484-103521506 GGCGGGCGGGTCCGCGCTGCGGG - Intronic
1122947767 14:105020998-105021020 GGCGGGCGGCCTCGCGGGTCAGG - Exonic
1124712889 15:32030252-32030274 GGCTCTCGGCCTCGCGCCTCTGG - Intergenic
1126800837 15:52295474-52295496 GGCGGGCGGGCGCGCGCTGGGGG - Intronic
1128068002 15:64776009-64776031 CCCGGGCGGCCTCGCGCTTAGGG + Intergenic
1129382856 15:75178711-75178733 GGCGGGCGGGCGCGGGCCTCAGG - Intergenic
1132163859 15:99566155-99566177 GGGGGGCGGCGTCTCGCTTAGGG + Intronic
1132653179 16:1030725-1030747 GGCGGGCGCCCTCCTGGTTCTGG + Intergenic
1132854171 16:2037410-2037432 GGCAGGGGGCCTCGGGCCTCTGG - Intronic
1132900558 16:2251721-2251743 CCCGGGCAGCCGCGCGCTTCCGG + Intronic
1133282685 16:4676171-4676193 GGCGGCCGGCCTCTCCCTCCAGG - Intronic
1136923369 16:34350232-34350254 GGGGGGCGGCCGCGGGCTCCCGG - Intergenic
1136981204 16:35061574-35061596 GGGGGGCGGCCGCGGGCTCCCGG + Intergenic
1138105860 16:54286906-54286928 GGTGGGCGGCCTCGCCCGTAAGG - Intergenic
1144695896 17:17303640-17303662 GGCGGGAGGCCGCGCCCTACGGG + Exonic
1151631759 17:75315798-75315820 GGCGCATGGCCTCGCTCTTCAGG - Intergenic
1160747639 19:719478-719500 GGCGGGGGGCGTGGCGCTCCAGG + Intronic
1160748585 19:723024-723046 GGCGGGGCGCCTCGGGCTCCAGG + Intronic
1160909684 19:1468877-1468899 GGCGGGCGGTGTGGCGCTTCTGG - Exonic
1163138754 19:15332289-15332311 GGCGTGCGGCCTAGCGTCTCAGG - Intronic
1163657802 19:18557882-18557904 GGCGGCCTTGCTCGCGCTTCCGG - Intronic
1164595505 19:29528795-29528817 GGCGAGCAGCCGCGCGCTCCCGG - Intronic
1167290740 19:48624209-48624231 TGGGCGGGGCCTCGCGCTTCGGG - Intronic
927184592 2:20473235-20473257 GGGGGGCGGCCTCTCCCTACAGG - Intergenic
930847651 2:55923282-55923304 GGCGGGCGGCCTGGCCCGGCAGG + Intronic
932421431 2:71603682-71603704 GACAGGCGGCCTCCTGCTTCTGG + Intronic
934966796 2:98730926-98730948 GGCTGGCGGCCCCGGGCTGCGGG - Intronic
941818767 2:169824898-169824920 CGCGTGCGGCCTGGCGCTTCCGG - Exonic
947791978 2:232873717-232873739 GGCGTGCTGCCTCAGGCTTCTGG - Intronic
948849978 2:240701142-240701164 GCCAGGCGGCCTCGCGCGGCAGG - Intergenic
1170991148 20:21303109-21303131 CGCGCTCGGCCTCGCGCTCCGGG + Intergenic
1171011292 20:21510752-21510774 GGTGGGCGGCCCTGGGCTTCCGG + Intergenic
1172443870 20:34983152-34983174 GGAGGGAGGCCTCGGGCTTCTGG - Intronic
1172627204 20:36354089-36354111 GCCGGCCGGCCTCCCGCCTCAGG + Intronic
1172838150 20:37886279-37886301 GGCCGGCGACTTGGCGCTTCGGG + Intergenic
1173874956 20:46364406-46364428 GGCATCCGGCCTCGCACTTCCGG - Exonic
1180042592 21:45287875-45287897 CCCGGGCGGCCACGCACTTCCGG + Exonic
1182664140 22:31944929-31944951 GGCGGGCGGCCACGCCCAGCCGG - Intronic
1183067260 22:35371867-35371889 GGCGGGTGGCATCGCGCCCCAGG - Intergenic
1184680702 22:46071099-46071121 GGCGGGCGGGCGCGAGCTCCCGG - Intronic
1185066267 22:48633120-48633142 TGGGGGCGGCCTGGCTCTTCGGG - Intronic
1185217466 22:49609681-49609703 GGCGGGAGGCCTGGAGCTGCTGG + Intronic
953980192 3:47409796-47409818 GGCGGGCAGCCTCGCGGGCCTGG - Exonic
963133066 3:141876353-141876375 GGCGGGCGTCCCCGCGCCGCAGG - Intronic
982712133 4:158768747-158768769 GGCGGCCGCCCTCGCCCCTCGGG + Intergenic
984972577 4:185204023-185204045 GGCGTGGGGCCCGGCGCTTCGGG + Intronic
992286111 5:75236983-75237005 CGCGCGCGGCCTCCCACTTCCGG - Intergenic
997869991 5:137498595-137498617 GGCGGGCGGCCGCGAGCCCCGGG + Intronic
1003085443 6:3056571-3056593 GGCGGGCGGCTTCGAGGATCAGG - Intergenic
1003325228 6:5085665-5085687 GGGGGGCGGCCTCTTCCTTCGGG - Exonic
1006113239 6:31761471-31761493 GGTGGATGGGCTCGCGCTTCTGG + Exonic
1014233987 6:118935059-118935081 GTCGGGCGGCCTAGCGCCTGCGG + Exonic
1023849093 7:44140475-44140497 GGAGGGCGGCCTGGGCCTTCTGG - Intronic
1027138313 7:75639529-75639551 GGCCGGCGGCCTCTCGCTCCGGG - Intronic
1029539012 7:101172219-101172241 GGCGCGGGGCCTGGCGCTGCAGG + Exonic
1031447645 7:121873698-121873720 AGCGGGCGGCCGCGCGGTGCAGG + Intronic
1034446283 7:151115714-151115736 GGCGAGCTGCCGCGCGCGTCCGG + Intronic
1039074882 8:33681119-33681141 GGCTGGCGGCCTCAAGCTCCTGG + Intergenic
1049442014 8:142613884-142613906 GGCGGTCGGCCCAGCGCTCCAGG + Exonic
1051071994 9:13180962-13180984 AGAGGGAGGCCTCGCTCTTCAGG - Intronic
1060838413 9:126775741-126775763 GGCTGGGGGCCTCTGGCTTCTGG - Intergenic
1061929839 9:133826821-133826843 GGCAGGCGGCCTGGCCCTGCTGG + Intronic
1187533481 X:20116709-20116731 GGCGGGCGCCCGAGGGCTTCGGG - Intronic