ID: 900238670

View in Genome Browser
Species Human (GRCh38)
Location 1:1604523-1604545
Sequence GAGCAGGGATGCAGCAGCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900238659_900238670 10 Left 900238659 1:1604490-1604512 CCCACCACCCAGGCCTCTGTTTT No data
Right 900238670 1:1604523-1604545 GAGCAGGGATGCAGCAGCCCCGG No data
900238665_900238670 -3 Left 900238665 1:1604503-1604525 CCTCTGTTTTCTCCCTGGTAGAG No data
Right 900238670 1:1604523-1604545 GAGCAGGGATGCAGCAGCCCCGG No data
900238663_900238670 2 Left 900238663 1:1604498-1604520 CCAGGCCTCTGTTTTCTCCCTGG No data
Right 900238670 1:1604523-1604545 GAGCAGGGATGCAGCAGCCCCGG No data
900238660_900238670 9 Left 900238660 1:1604491-1604513 CCACCACCCAGGCCTCTGTTTTC No data
Right 900238670 1:1604523-1604545 GAGCAGGGATGCAGCAGCCCCGG No data
900238655_900238670 24 Left 900238655 1:1604476-1604498 CCGGAAGCCACGGCCCCACCACC No data
Right 900238670 1:1604523-1604545 GAGCAGGGATGCAGCAGCCCCGG No data
900238662_900238670 3 Left 900238662 1:1604497-1604519 CCCAGGCCTCTGTTTTCTCCCTG No data
Right 900238670 1:1604523-1604545 GAGCAGGGATGCAGCAGCCCCGG No data
900238658_900238670 11 Left 900238658 1:1604489-1604511 CCCCACCACCCAGGCCTCTGTTT No data
Right 900238670 1:1604523-1604545 GAGCAGGGATGCAGCAGCCCCGG No data
900238661_900238670 6 Left 900238661 1:1604494-1604516 CCACCCAGGCCTCTGTTTTCTCC No data
Right 900238670 1:1604523-1604545 GAGCAGGGATGCAGCAGCCCCGG No data
900238657_900238670 17 Left 900238657 1:1604483-1604505 CCACGGCCCCACCACCCAGGCCT No data
Right 900238670 1:1604523-1604545 GAGCAGGGATGCAGCAGCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900238670 Original CRISPR GAGCAGGGATGCAGCAGCCC CGG Intergenic
No off target data available for this crispr