ID: 900240323

View in Genome Browser
Species Human (GRCh38)
Location 1:1614203-1614225
Sequence GACTCCATTTGTTTAGGGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900240323_900240335 24 Left 900240323 1:1614203-1614225 CCAATCCCTAAACAAATGGAGTC No data
Right 900240335 1:1614250-1614272 CATGCAGGAATACCTGCAGCAGG No data
900240323_900240329 -8 Left 900240323 1:1614203-1614225 CCAATCCCTAAACAAATGGAGTC No data
Right 900240329 1:1614218-1614240 ATGGAGTCGGGAGGCCACGAAGG No data
900240323_900240334 9 Left 900240323 1:1614203-1614225 CCAATCCCTAAACAAATGGAGTC No data
Right 900240334 1:1614235-1614257 CGAAGGGGGAGCTCTCATGCAGG No data
900240323_900240331 -6 Left 900240323 1:1614203-1614225 CCAATCCCTAAACAAATGGAGTC No data
Right 900240331 1:1614220-1614242 GGAGTCGGGAGGCCACGAAGGGG No data
900240323_900240330 -7 Left 900240323 1:1614203-1614225 CCAATCCCTAAACAAATGGAGTC No data
Right 900240330 1:1614219-1614241 TGGAGTCGGGAGGCCACGAAGGG No data
900240323_900240332 -5 Left 900240323 1:1614203-1614225 CCAATCCCTAAACAAATGGAGTC No data
Right 900240332 1:1614221-1614243 GAGTCGGGAGGCCACGAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900240323 Original CRISPR GACTCCATTTGTTTAGGGAT TGG (reversed) Intergenic