ID: 900240771

View in Genome Browser
Species Human (GRCh38)
Location 1:1616226-1616248
Sequence CGCCGGCGCAGGGGAACGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 162}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900240771_900240777 -7 Left 900240771 1:1616226-1616248 CCGCCCGTTCCCCTGCGCCGGCG 0: 1
1: 0
2: 1
3: 18
4: 162
Right 900240777 1:1616242-1616264 GCCGGCGCCCGTGCGCGTCCCGG 0: 1
1: 0
2: 1
3: 13
4: 125
900240771_900240784 19 Left 900240771 1:1616226-1616248 CCGCCCGTTCCCCTGCGCCGGCG 0: 1
1: 0
2: 1
3: 18
4: 162
Right 900240784 1:1616268-1616290 CTCCTGACGTCTGCGAGCCGCGG 0: 1
1: 0
2: 1
3: 3
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900240771 Original CRISPR CGCCGGCGCAGGGGAACGGG CGG (reversed) Intronic