ID: 900240771

View in Genome Browser
Species Human (GRCh38)
Location 1:1616226-1616248
Sequence CGCCGGCGCAGGGGAACGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 162}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900240771_900240777 -7 Left 900240771 1:1616226-1616248 CCGCCCGTTCCCCTGCGCCGGCG 0: 1
1: 0
2: 1
3: 18
4: 162
Right 900240777 1:1616242-1616264 GCCGGCGCCCGTGCGCGTCCCGG 0: 1
1: 0
2: 1
3: 13
4: 125
900240771_900240784 19 Left 900240771 1:1616226-1616248 CCGCCCGTTCCCCTGCGCCGGCG 0: 1
1: 0
2: 1
3: 18
4: 162
Right 900240784 1:1616268-1616290 CTCCTGACGTCTGCGAGCCGCGG 0: 1
1: 0
2: 1
3: 3
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900240771 Original CRISPR CGCCGGCGCAGGGGAACGGG CGG (reversed) Intronic
900151465 1:1180938-1180960 GGCGGGCGCAGGGGCAGGGGTGG - Intronic
900240771 1:1616226-1616248 CGCCGGCGCAGGGGAACGGGCGG - Intronic
900269171 1:1778415-1778437 CGCCGGCGCCGGGGTCCGGGCGG - Intronic
900301553 1:1980531-1980553 CGCAGGCGCTGAGGACCGGGAGG + Intronic
900513213 1:3069882-3069904 CGCGGGCGCAGGGGCAGGGGTGG + Intronic
901199166 1:7457039-7457061 CGGCGGCGCAGGGGGCGGGGCGG - Intronic
901741687 1:11345930-11345952 CACCGGGGCTGGGGAAGGGGTGG + Intergenic
901934516 1:12618373-12618395 CGACGGCGCAGGGGGAGGGGAGG - Intergenic
903652332 1:24929796-24929818 CGCCGCCGCAGGGGAAGGCCGGG + Exonic
904181401 1:28668997-28669019 CGCCGCCGCCGGGGAGCGAGCGG + Intronic
904467827 1:30718603-30718625 CGCCGGCGCAGGGCAGGGGCGGG - Intronic
906805538 1:48776515-48776537 CCCGGGCGGAGGGGACCGGGGGG - Intronic
907268510 1:53276929-53276951 CGCCGCCGCAGCGGAACTCGCGG + Exonic
907883875 1:58576157-58576179 CGGCGGGGCAGGGGATGGGGTGG - Exonic
911348138 1:96721681-96721703 CGCCGGCGCCCGGCAGCGGGAGG - Intronic
911647465 1:100352231-100352253 CCTCGGCCCAGGGGAGCGGGCGG - Intronic
914718298 1:150268941-150268963 CCCCGGGGAAGGGGAAGGGGGGG + Exonic
916118984 1:161511613-161511635 CCCCTGAGCAGGGGAACTGGGGG + Intronic
918015989 1:180632533-180632555 GGCCGGGGCCGGGGAACGGTGGG + Intronic
920666143 1:207964049-207964071 CGGCGGCCCAGGGGAGAGGGAGG + Intergenic
921029697 1:211326755-211326777 CGCGGGCGGAGGGGCGCGGGCGG - Intronic
921944969 1:220880010-220880032 CGCCGGCGTGGGGGATCTGGGGG + Exonic
922134837 1:222814902-222814924 CGCCGGCGGCGGGCGACGGGCGG - Intergenic
922739364 1:228006869-228006891 CGCCGGGGCCGGGGCCCGGGCGG - Intergenic
1070592899 10:77812948-77812970 CGCCGGGGCAGGGGCTCGGCAGG + Intronic
1070800828 10:79243548-79243570 CGGCGGCGCGGGGGCCCGGGCGG - Intronic
1076379459 10:130015186-130015208 CGCCGGTGAGGGTGAACGGGTGG + Intergenic
1077018475 11:407183-407205 CGGCGGCGCAGGGGCGGGGGCGG + Intronic
1077444222 11:2582840-2582862 TGCCAGCGCGGGGGAAAGGGTGG + Intronic
1082739458 11:56894503-56894525 GGCTGGGGCAGGGGAAAGGGAGG + Intergenic
1083419665 11:62545882-62545904 CGCCTCCGGAGGGGAAGGGGCGG + Intronic
1083869370 11:65477499-65477521 CCCCGGCGCGGGGGCAGGGGAGG + Intergenic
1084586923 11:70067749-70067771 AGCCGGGGCAGGGGGTCGGGAGG - Intergenic
1084981119 11:72829288-72829310 CGGCAGCGCTGGGGAAAGGGAGG - Exonic
1089559945 11:119338791-119338813 AGCCGGCCCAGGGGAATGAGAGG - Intergenic
1098255443 12:68611105-68611127 CGCCGGCTGAGGGGAGCGGGTGG + Intronic
1102278358 12:111599395-111599417 GGCCGGCGCGGCGGAGCGGGCGG - Exonic
1103309021 12:119989687-119989709 CGCCGGCGCGGGGGAGGGGCGGG + Intergenic
1106847473 13:33751793-33751815 CTCTGGCGGAGGGGGACGGGGGG - Intergenic
1113480418 13:110616021-110616043 CGCGGTGGCCGGGGAACGGGGGG + Intronic
1113653852 13:112056263-112056285 CGGAGGCGCAGGGGAGCAGGAGG + Intergenic
1117131979 14:52695763-52695785 CGCGGGCGCAGCGGACCGGGCGG - Intronic
1117424463 14:55580385-55580407 CGCCGGCGGCGGGGAGCGCGGGG + Intronic
1118350995 14:64972357-64972379 CGGCGGCGCAGGGGAAGGGGCGG - Intronic
1120914796 14:89701676-89701698 CGCCGGCGCCGGGAAGCGGGGGG - Intergenic
1122263866 14:100537864-100537886 GGCCGGGGCAGGGGAACAGCGGG + Exonic
1122784876 14:104159006-104159028 CGCCGGCCCTGGGGACCGTGTGG + Intronic
1122912313 14:104836851-104836873 CGCCGGTGCAGGGGGGGGGGGGG - Intergenic
1202899773 14_GL000194v1_random:28353-28375 CGCCGGCGCAGGCGCCGGGGGGG - Intergenic
1123480683 15:20628734-20628756 CGCCGCCCGAGGAGAACGGGAGG - Intergenic
1123637326 15:22371633-22371655 CGCCGCCCGAGGAGAACGGGAGG + Intergenic
1124244467 15:28057768-28057790 CGCTGCTGCAGGGGAACAGGTGG + Intronic
1131517344 15:93088393-93088415 CGCCGGCGTACGGGAAGGTGCGG - Intronic
1132370589 15:101295186-101295208 CCACAGCGCGGGGGAACGGGAGG - Exonic
1132828896 16:1918141-1918163 GGCCGGCGCGGGGGCGCGGGCGG + Exonic
1132900429 16:2251304-2251326 CGCGGGCGCAGGTGAGCGGGCGG - Exonic
1132902974 16:2268401-2268423 CGCCCGCGCAAGGAAAGGGGCGG - Intronic
1133156769 16:3881096-3881118 CGCCGCCCCAGCGGGACGGGCGG - Intergenic
1133232155 16:4371961-4371983 CGGCGGCGCAGGGAGCCGGGCGG - Exonic
1136735318 16:32461789-32461811 CGCCAGCGCAGGGCACCGAGAGG - Intergenic
1137585962 16:49664249-49664271 CGCCGGCCCAGGCGGCCGGGTGG - Intronic
1142179781 16:88662795-88662817 AGCCGTCGCGGGGGAACGGGTGG + Intronic
1142498836 17:321200-321222 CGCAAGCGCAGGGGACTGGGAGG - Intronic
1142859952 17:2755522-2755544 CGCCGGCCCCGCAGAACGGGCGG - Intergenic
1143299408 17:5898599-5898621 GGCCGGCGCAGGGTAAGGGAGGG + Intronic
1143515725 17:7418352-7418374 CGCCGGGGTAGGGGCAAGGGAGG - Exonic
1144869925 17:18363197-18363219 CGCCTGGGCTGGGGATCGGGCGG - Intronic
1146955856 17:36936106-36936128 CGCCGGCGCGGGGGAAGGAGTGG - Intergenic
1147971297 17:44220070-44220092 TGCCGCCGCCGGGGAAGGGGGGG + Intronic
1148437302 17:47694352-47694374 CGGCGGCGGAGGGGGACGCGAGG - Intronic
1148633949 17:49132914-49132936 CGCCGGAGCCAGGGAGCGGGCGG + Intronic
1152310419 17:79546621-79546643 TGCCGGCGGATGGGAATGGGAGG - Intergenic
1152952844 18:11080-11102 CGCCGGCGCAGGCGCAGGCGCGG + Intergenic
1152952852 18:11115-11137 CGCCGGCGCAGGCGCAGGCGCGG + Intergenic
1155284260 18:24272048-24272070 CAGCGGCGCTGGGGAAGGGGAGG - Intronic
1159040680 18:63320398-63320420 CGCGGGCGCAGCGGAGCGGGCGG - Intergenic
1160024929 18:75209227-75209249 CGCCGGCGCCGGGGAGGCGGGGG - Exonic
1160950752 19:1666078-1666100 GGCAGGCCCAGGGGCACGGGAGG + Intergenic
1161344816 19:3763087-3763109 CGCCTGCGCAGTGAAACGCGTGG - Intronic
1161562022 19:4978724-4978746 CGCTGGCTCAGGGGCGCGGGAGG + Intronic
1161768062 19:6217582-6217604 CGCTGGCCCTGGGGAGCGGGTGG + Intronic
1162094801 19:8304020-8304042 CGCCGGTGCAGGGGCAGGGGAGG + Exonic
1162200740 19:9018317-9018339 GGCGGGCGGAGGGGAACTGGAGG - Intergenic
1162779956 19:13001893-13001915 CGCCAGGCCAGGGGCACGGGCGG - Intronic
1164693633 19:30227874-30227896 GGCCGGCGGAGGGGACCGGCGGG + Intergenic
1165760056 19:38315831-38315853 GGCCGGCGGAGGAGATCGGGCGG - Intronic
1165940365 19:39412262-39412284 CCCCGGCGCAGGGGTGCGGCCGG - Intergenic
1166304258 19:41928601-41928623 CGGCGGCGCGGGGGAGGGGGCGG + Intronic
1166750235 19:45161056-45161078 GGCAGGCGCTGGGGAAGGGGCGG - Intronic
1167696262 19:51017159-51017181 CACCCGCGCAGTGGAACGAGAGG + Exonic
1168336517 19:55600333-55600355 GGCCGGCGCGTGGGAAGGGGAGG - Intronic
1168336895 19:55602185-55602207 CGGCGGCCCCGGGGAACAGGAGG - Exonic
1168434152 19:56304182-56304204 AGCCAGCGCAGGGGACCTGGCGG + Intronic
1168728562 19:58606494-58606516 TGCTGGCGCAGGGGCACGGCAGG - Intergenic
925926686 2:8676270-8676292 CGCGGGCGGAGGGGACCTGGAGG - Intergenic
925982639 2:9189627-9189649 CGCAGGCAGAGGGGAAGGGGTGG + Intergenic
928344318 2:30476729-30476751 GGCAGGGGCAGGGGAAGGGGTGG - Intronic
929188547 2:39120269-39120291 CGCGGGCGCTGGGGAAGGGCTGG - Intronic
929857891 2:45651398-45651420 CGCCGGAGCCGGCGATCGGGAGG - Intronic
930089404 2:47520883-47520905 CCCCGGCGCGGGCGGACGGGCGG + Exonic
930358271 2:50347011-50347033 AGAGGGCGCAGGGGAGCGGGCGG + Intronic
931348878 2:61470939-61470961 CGCCGGCGGCGGGGAAGGGGGGG + Intergenic
932555974 2:72825516-72825538 GTCCGGCGCTGGGGAACGAGAGG - Intronic
934678247 2:96265323-96265345 CGCCGGCGGAGGAGCCCGGGAGG - Exonic
935196486 2:100819793-100819815 CGCCGGGGCTGGGGGAGGGGGGG - Intergenic
938639823 2:133266730-133266752 GGCAGGCGCAGGGGGACTGGCGG - Intronic
942241107 2:173964673-173964695 CGCCGCCGCCGGGGGGCGGGTGG - Intronic
946149798 2:217756667-217756689 GGCCCGGGCAGGGGAAGGGGTGG - Intergenic
948893089 2:240916465-240916487 CGGGGGCGCGGGGGCACGGGGGG - Intergenic
1173166123 20:40688403-40688425 CGCCGGCGCCCGGGTACGCGTGG + Exonic
1173813731 20:45971844-45971866 CGCCTCCGCAGGGGAACCGGGGG - Intronic
1175134302 20:56811362-56811384 AGCCGGAGCAGGGGAAAGGTGGG - Intergenic
1176198700 20:63849889-63849911 CGGCGGGGCAGGGGACCCGGCGG - Intergenic
1176198716 20:63849940-63849962 CGGCGGGGCAGGGGACCCGGCGG - Intergenic
1176414523 21:6467209-6467231 CGCCGGCGCGGGGGCTGGGGTGG + Intergenic
1178513826 21:33229893-33229915 CGCCGGCGCGGGGGCGGGGGCGG - Intronic
1179690021 21:43075531-43075553 CGCCGGCGCGGGGGCTGGGGTGG + Intronic
1179893842 21:44350700-44350722 CGCTGGTGCAGGGGCACCGGTGG + Intronic
1183437144 22:37802739-37802761 CCCCGGAACAGGGGAAGGGGCGG + Intergenic
1183683683 22:39349920-39349942 CGCGCGCGCAGGGGAGGGGGCGG + Intronic
1185279147 22:49962488-49962510 GGCCGGCGGAGGGGGACGGCCGG + Intronic
1185409498 22:50674542-50674564 CTCCGGCGGGGGGGAAGGGGGGG + Intergenic
1185424179 22:50755441-50755463 CCACAGCGCGGGGGAACGGGAGG - Intergenic
949260456 3:2098710-2098732 CGCGGGCGGGTGGGAACGGGCGG - Intergenic
954072267 3:48151562-48151584 AGCCAGGGCAGGGGAAGGGGTGG + Intergenic
959530736 3:107431544-107431566 CGCCGCCGCCGGGGCTCGGGCGG + Intergenic
960739593 3:120818541-120818563 CGCGGGGGCAGGGGCAAGGGAGG - Intergenic
961858286 3:129893776-129893798 CGCACGCGCAAGGGAGCGGGCGG + Intergenic
969138746 4:5051483-5051505 CGCGGGAGCAGGGGAAGGAGGGG - Exonic
969587482 4:8102846-8102868 CACCGGCAAAGAGGAACGGGGGG - Intronic
969700404 4:8764743-8764765 CGACGGGGCAGGGGAGGGGGTGG - Intergenic
969734362 4:8977185-8977207 ATCCGGGGCCGGGGAACGGGGGG - Intergenic
971322931 4:25619990-25620012 AGCCGGGGCAGGGGGGCGGGGGG + Intergenic
973893484 4:55390612-55390634 TGCTGGTGCAGGGGAAAGGGAGG - Intergenic
979205536 4:118033546-118033568 CGCCCGCCCCGGGGAAGGGGAGG - Intergenic
981550292 4:145936637-145936659 TGCCTGCCCAGGGGACCGGGAGG - Intronic
984928527 4:184826576-184826598 CGCCGGTGCAGGGGAGCTGAGGG + Exonic
990456584 5:55994877-55994899 CCCCGGCGCAGCTGAACCGGGGG - Exonic
990743709 5:58937253-58937275 GGCGGGAGCAGGGGAAGGGGAGG + Intergenic
991361776 5:65828198-65828220 CACCGGGGGAGGGGGACGGGAGG + Exonic
992529167 5:77638833-77638855 GGCGGGCGCAGGCGAGCGGGCGG - Exonic
996379048 5:122845526-122845548 CGCGGGCGCAGCGGGGCGGGAGG + Exonic
996398591 5:123036383-123036405 CCCGGGCGCAGGGGGACTGGAGG - Intronic
997222552 5:132181297-132181319 GGCCTGCGCGGGGGAAGGGGTGG + Intergenic
997521634 5:134527227-134527249 CGCAGGCGCAGGCGAGTGGGTGG - Intronic
1000220460 5:159209309-159209331 CGCCGCCCGAGGAGAACGGGAGG - Intronic
1003004569 6:2369035-2369057 CGCTGGAGCTGGGGAGCGGGAGG + Intergenic
1003051532 6:2785118-2785140 CTCAGGTGCAGGGGCACGGGGGG - Exonic
1005068858 6:21845728-21845750 CGCTGGCACAGGGGAAGGTGAGG + Intergenic
1006396251 6:33789177-33789199 CGCAGGCGCGGCGGAGCGGGCGG + Intergenic
1008382429 6:50850004-50850026 TCCCGGCGGAGAGGAACGGGAGG - Intergenic
1008649063 6:53544939-53544961 CGCCGCCGCATCGGAGCGGGAGG - Exonic
1012980994 6:105830856-105830878 CGCAGGAGGAGGGGAAAGGGAGG + Intergenic
1014913186 6:127118123-127118145 CGCCGGCGCTGGGGATGGGGTGG + Intergenic
1014947591 6:127516062-127516084 CGGCGGCTCCGGGGAAAGGGAGG - Exonic
1015965398 6:138692439-138692461 GGCCGGGGGAGGGGAACCGGCGG - Intronic
1018046401 6:159969565-159969587 CGCCTGCGCACGGGACCCGGCGG - Intronic
1019521462 7:1462360-1462382 CGCTGGTGCAGGGGACTGGGAGG + Intergenic
1020288795 7:6706696-6706718 CGACGGCGGAGGCGAAGGGGCGG - Exonic
1023287106 7:38631401-38631423 CGGCGGCGCGGAGGAGCGGGAGG + Exonic
1027244783 7:76359394-76359416 CGCAGGCGCAGGAGGACGGGGGG + Intergenic
1029238626 7:99143481-99143503 GGCAGGTGCGGGGGAACGGGAGG + Intronic
1030358468 7:108569653-108569675 CGCAGGCGCAGGGGCTCGAGAGG - Exonic
1032151442 7:129433521-129433543 CGTAGGCTCAGGGGAACAGGTGG - Intergenic
1035441850 7:158908722-158908744 CTCCGGCTCAGGGGAAGGGGTGG - Intronic
1039921668 8:41897503-41897525 CGCCGGGGATGGGGGACGGGCGG - Intergenic
1042267623 8:66925327-66925349 CCCGGGCGCAGCGGAGCGGGCGG - Intergenic
1049390560 8:142367512-142367534 CGCCGGGGCGGGGGAGGGGGAGG + Intronic
1049405376 8:142449882-142449904 AGCAGGCGCGGGGGAACGGGAGG + Exonic
1055945264 9:81687750-81687772 CGCCGCCGTGGGGGAAGGGGCGG - Intronic
1058508850 9:105694549-105694571 AGCCGGCGCGGAGGAGCGGGCGG + Exonic
1058975412 9:110121510-110121532 AGCAGGTGCAGGGGAAAGGGTGG - Intronic
1060209095 9:121699474-121699496 CGGCGGCGCGGGGGACCGGGCGG - Intronic
1060945897 9:127569161-127569183 GGCGGGCGCAGGGCAGCGGGCGG - Intronic
1061134318 9:128724401-128724423 GGCGGGCACAGGGGAACGCGGGG - Intergenic
1061450479 9:130664616-130664638 CCCCGGCGCCGGGGGACGGCCGG - Exonic
1061580116 9:131531210-131531232 CGCCGGGCCTGGGGAAGGGGCGG - Intronic
1062105762 9:134753940-134753962 CGCTGCCGCCGGAGAACGGGAGG - Intronic
1062488147 9:136791320-136791342 CGCAGGCGCAGGCGGAAGGGCGG - Intergenic
1062491656 9:136807922-136807944 CGCCGGCTCGGCGGGACGGGAGG - Exonic
1198205313 X:134460080-134460102 CGCCGGCGTAGGCGCGCGGGCGG + Intergenic
1198479853 X:137031320-137031342 CGCTGGCGAAGGCGAACAGGTGG + Exonic